Virus Imaging

Select by virus name
About Images
Art Gallery
Covers Gallery
ICTV 8th Color Plates
PS10 Screen Saver   

Virus Structure Tutorials

Triangulation Number
Topography Maps 3D


Virology Links

In the News

- News -
- Video -
- Blogs -
 * Virology Highlights
- Flu & H1N1 - (CDC|WHO)

Journal Contents

Science
Nature
Nature Structural & Molecular Biology

Structure & Assembly (J.Virol)
Journal of Virology
J. General Virology
Retrovirology
Virology
Virology Journal
Virus Genes
Viruses

Educational Resouces


Video Lectures  NEW 
TextBook  NEW 
Educational Links
Educational Kids

Legacy

Archived Web Papers

Jean-Yves Sgro
Inst. for Mol.Virology
731B Bock Labs
1525 Linden Drive Madison, WI 53706

Table of Contents for this page:

  • Current Issue
  • Advanced Online Publications Articles
  • Current Issue of Journal of Virology

    JVI Current Issue

  • Editorial Board [Masthead]

  • Articles of Significant Interest Selected from This Issue by the Editors [Spotlight]

  • Contribution of PDZD8 to Stabilization of the Human Immunodeficiency Virus Type 1 Capsid [Virus-Cell Interactions]

  • Following human immunodeficiency virus type 1 (HIV-1) entry into the host cell, the viral capsid gradually disassembles in a process called uncoating. A proper rate of uncoating is important for reverse transcription of the HIV-1 genome. Host restriction factors such as TRIM5aalpha; and TRIMCyp bind retroviral capsids and cause premature disassembly, leading to blocks in reverse transcription. Other host factors, such as cyclophilin A, stabilize the HIV-1 capsid and are required for efficient infection in some cell types. Here, we show that a heat-labile factor greater than 100 kDa in the cytoplasm of cells from multiple vertebrate species slows the spontaneous disassembly of HIV-1 capsid-nucleocapsid (CA-NC) complexes in vitro. We identified the PDZ domain-containing protein 8 (PDZD8) as a critical component of the capsid-stabilizing activity in the cytoplasmic extracts. PDZD8 has been previously reported to bind the HIV-1 Gag polyprotein and to make a positive contribution to the efficiency of HIV-1 infection (M. S. Henning, S. G. Morham, S. P. Goff, and M. H. Naghavi, J. Virol. 84:8990nndash;8995, 2010, doi:10.1128/JVI.00843nndash;10). PDZD8 knockdown accelerated the disassembly of HIV-1 capsids in infected cells, resulting in decreased reverse transcription. The PDZD8 coiled-coil domain is sufficient for HIV-1 capsid binding, but other parts of the protein, including the PDZ domain, are apparently required for stabilizing the capsid and supporting HIV-1 infection. In summary, PDZD8 interacts with and stabilizes the HIV-1 capsid and thus represents a potentially targetable host cofactor for HIV-1 infection.

    IMPORTANCE After human immunodeficiency virus type 1 (HIV-1) gains access to the interior of the target cell, host cell factors can influence virus infection in either a positive or negative way. HIV-1 depends upon certain host cell factors to assist processes that are required for virus replication. One example of such a host factor is PDZD8. This work shows that PDZD8 helps to stabilize the HIV-1 capsid, a huge complex of the viral RNA, enzymes, and protein. When PDZD8 is prevented from interacting with the HIV-1 capsid, the capsid becomes unstable and HIV-1 infection is inhibited. These results show that PDZD8 regulates the uncoating of the HIV-1 capsid. Interfering with the interaction of PDZD8 and capsid could prove to be a useful strategy for intervening in HIV-1 infection and transmission.

  • A Recombinant Hendra Virus G Glycoprotein Subunit Vaccine Protects Nonhuman Primates against Hendra Virus Challenge [Vaccines and Antiviral Agents]

  • Hendra virus (HeV) is a zoonotic emerging virus belonging to the family Paramyxoviridae. HeV causes severe and often fatal respiratory and/or neurologic disease in both animals and humans. Currently, there are no licensed vaccines or antiviral drugs approved for human use. A number of animal models have been developed for studying HeV infection, with the African green monkey (AGM) appearing to most faithfully reproduce the human disease. Here, we assessed the utility of a newly developed recombinant subunit vaccine based on the HeV attachment (G) glycoprotein in the AGM model. Four AGMs were vaccinated with two doses of the HeV vaccine (sGHeV) containing Alhydrogel, four AGMs received the sGHeV with Alhydrogel and CpG, and four control animals did not receive the sGHeV vaccine. Animals were challenged with a high dose of infectious HeV 21 days after the boost vaccination. None of the eight specifically vaccinated animals showed any evidence of clinical illness and survived the challenge. All four controls became severely ill with symptoms consistent with HeV infection, and three of the four animals succumbed 8 days after exposure. Success of the recombinant subunit vaccine in AGMs provides pivotal data in supporting its further preclinical development for potential human use.

    IMPORTANCE A Hendra virus attachment (G) glycoprotein subunit vaccine was tested in nonhuman primates to assess its ability to protect them from a lethal infection with Hendra virus. It was found that all vaccinated African green monkeys were completely protected against subsequent Hendra virus infection and disease. The success of this new subunit vaccine in nonhuman primates provides critical data in support of its further development for future human use.

  • An Unbiased Genetic Screen Reveals the Polygenic Nature of the Influenza Virus Anti-Interferon Response [Virus-Cell Interactions]

  • Influenza A viruses counteract the cellular innate immune response at several steps, including blocking RIG I-dependent activation of interferon (IFN) transcription, interferon (IFN)-dependent upregulation of IFN-stimulated genes (ISGs), and the activity of various ISG products; the multifunctional NS1 protein is responsible for most of these activities. To determine the importance of other viral genes in the interplay between the virus and the host IFN response, we characterized populations and selected mutants of wild-type viruses selected by passage through non-IFN-responsive cells. We reasoned that, by allowing replication to occur in the absence of the selection pressure exerted by IFN, the virus could mutate at positions that would normally be restricted and could thus find new optimal sequence solutions. Deep sequencing of selected virus populations and individual virus mutants indicated that nonsynonymous mutations occurred at many phylogenetically conserved positions in nearly all virus genes. Most individual mutants selected for further characterization induced IFN and ISGs and were unable to counteract the effects of exogenous IFN, yet only one contained a mutation in NS1. The relevance of these mutations for the virus phenotype was verified by reverse genetics. Of note, several virus mutants expressing intact NS1 proteins exhibited alterations in the M1/M2 proteins and accumulated large amounts of deleted genomic RNAs but nonetheless replicated to high titers. This suggests that the overproduction of IFN inducers by these viruses can override NS1-mediated IFN modulation. Altogether, the results suggest that influenza viruses replicating in IFN-competent cells have tuned their complete genomes to evade the cellular innate immune system and that serial replication in non-IFN-responsive cells allows the virus to relax from these constraints and find a new genome consensus within its sequence space.

    IMPORTANCE In natural virus infections, the production of interferons leads to an antiviral state in cells that effectively limits virus replication. The interferon response places considerable selection pressure on viruses, and they have evolved a variety of ways to evade it. Although the influenza virus NS1 protein is a powerful interferon antagonist, the contributions of other viral genes to interferon evasion have not been well characterized. Here, we examined the effects of alleviating the selection pressure exerted by interferon by serially passaging influenza viruses in cells unable to respond to interferon. Viruses that grew to high titers had mutations at many normally conserved positions in nearly all genes and were not restricted to the NS1 gene. Our results demonstrate that influenza viruses have fine-tuned their entire genomes to evade the interferon response, and by removing interferon-mediated constraints, viruses can mutate at genome positions normally restricted by the interferon response.

  • Inhibition of Hepatitis C Virus in Chimeric Mice by Short Synthetic Hairpin RNAs: Sequence Analysis of Surviving Virus Shows Added Selective Pressure of Combination Therapy [Vaccines and Antiviral Agents]

  • We have recently shown that a cocktail of two short synthetic hairpin RNAs (sshRNAs), targeting the internal ribosome entry site of hepatitis C virus (HCV) formulated with lipid nanoparticles, was able to suppress viral replication in chimeric mice infected with HCV GT1a by up to 2.5 log10 (H. Ma et al., Gastroenterology 146:63nndash;66.e5, http://dx.doi.org/10.1053/j.gastro.2013.09.049) Viral load remained about 1 log10 below pretreatment levels 21 days after the end of dosing. We have now sequenced the HCV viral RNA amplified from serum of treated mice after the 21-day follow-up period. Viral RNA from the HCV sshRNA-treated groups was altered in sequences complementary to the sshRNAs and nowhere else in the 500-nucleotide sequenced region, while the viruses from the control group that received an irrelevant sshRNA had no mutations in that region. The ability of the most commonly selected mutations to confer resistance to the sshRNAs was confirmed in vitro by introducing those mutations into HCV-luciferase reporters. The mutations most frequently selected by sshRNA treatment within the sshRNA target sequence occurred at the most polymorphic residues, as identified from an analysis of available clinical isolates. These results demonstrate a direct antiviral activity with effective HCV suppression, demonstrate the added selective pressure of combination therapy, and confirm an RNA interference (RNAi) mechanism of action.

    IMPORTANCE This study presents a detailed analysis of the impact of treating a hepatitis C virus (HCV)-infected animal with synthetic hairpin-shaped RNAs that can degrade the virus's RNA genome. These RNAs can reduce the viral load in these animals by over 99% after 1 to 2 injections. The study results confirm that the viral rebound that often occurred a few weeks after treatment is due to emergence of a virus whose genome is mutated in the sequences targeted by the RNAs. The use of two RNA inhibitors, which is more effective than use of either one by itself, requires that any resistant virus have mutations in the targets sites of both agents, a higher hurdle, if the virus is to retain the ability to replicate efficiently. These results demonstrate a direct antiviral activity with effective HCV suppression, demonstrate the added selective pressure of combination therapy, and confirm an RNAi mechanism of action.

  • Herpes Simplex Virus 1 UL47 Interacts with Viral Nuclear Egress Factors UL31, UL34, and Us3 and Regulates Viral Nuclear Egress [Structure and Assembly]

  • Herpesviruses have evolved a unique mechanism for nuclear egress of nascent progeny nucleocapsids: the nucleocapsids bud through the inner nuclear membrane into the perinuclear space between the inner and outer nuclear membranes (primary envelopment), and enveloped nucleocapsids then fuse with the outer nuclear membrane to release nucleocapsids into the cytoplasm (de-envelopment). We have shown that the herpes simplex virus 1 (HSV-1) major virion structural protein UL47 (or VP13/VP14) is a novel regulator for HSV-1 nuclear egress. In particular, we demonstrated the following: (i) UL47 formed a complex(es) with HSV-1 proteins UL34, UL31, and/or Us3, which have all been reported to be critical for viral nuclear egress, and these viral proteins colocalized at the nuclear membrane in HSV-1-infected cells; (ii) the UL47-null mutation considerably reduced primary enveloped virions in the perinuclear space although capsids accumulated in the nucleus; and (iii) UL47 was detected in primary enveloped virions in the perinuclear space by immunoelectron microscopy. These results suggested that UL47 promoted HSV-1 primary envelopment, probably by interacting with the critical HSV-1 regulators for viral nuclear egress and by modulating their functions.

    IMPORTANCE Like other herpesviruses, herpes simplex virus 1 (HSV-1) has evolved a vesicle-mediated nucleocytoplasmic transport mechanism for nuclear egress of nascent progeny nucleocapsids. Although previous reports identified and characterized several HSV-1 and cellular proteins involved in viral nuclear egress, complete details of HSV-1 nuclear egress remain to be elucidated. In this study, we have presented data suggesting (i) that the major HSV-1 virion structural protein UL47 (or VP13/VP14) formed a complex with known viral regulatory proteins critical for viral nuclear egress and (ii) that UL47 played a regulatory role in HSV-1 primary envelopment. Thus, we identified UL47 as a novel regulator for HSV-1 nuclear egress.

  • Differential Escape Patterns within the Dominant HLA-B*57:03-Restricted HIV Gag Epitope Reflect Distinct Clade-Specific Functional Constraints [Pathogenesis and Immunity]

  • HLA-B*57:01 and HLA-B*57:03, the most prevalent HLA-B*57 subtypes in Caucasian and African populations, respectively, are the HLA alleles most protective against HIV disease progression. Understanding the mechanisms underlying this immune control is of critical importance, yet they remain unclear. Unexplained differences are observed in the impact of the dominant cytotoxic T lymphocyte (CTL) response restricted by HLA-B*57:01 and HLA-B*57:03 in chronic infection on the Gag epitope KAFSPEVIPMF (KF11; Gag 162 to 172). We previously showed that the HLA-B*57:03-KF11 response is associated with a ggt;1-log-lower viral setpoint in C clade virus infection and that this response selects escape mutants within the epitope. We first examined the relationship of KF11 responses in B clade virus-infected subjects with HLA-B*57:01 to immune control and observed that a detectable KF11 response was associated with a ggt;1-log-higher viral load (P = 0.02). No evidence of HLA-B*57:01-KF11-associated selection pressure was identified in previous comprehensive analyses of ggt;1,800 B clade virus-infected subjects. We then studied a B clade virus-infected cohort in Barbados, where HLA-B*57:03 is highly prevalent. In contrast to findings for B clade virus-infected subjects expressing HLA-B*57:01, we observed strong selection pressure driven by the HLA-B*57:03-KF11 response for the escape mutation S173T. This mutation reduces recognition of virus-infected cells by HLA-B*57:03-KF11 CTLs and is associated with a ggt;1-log increase in viral load in HLA-B*57:03-positive subjects (P = 0.009). We demonstrate functional constraints imposed by HIV clade relating to the residue at Gag 173 that explain the differential clade-specific escape patterns in HLA-B*57:03 subjects. Further studies are needed to evaluate the role of the KF11 response in HLA-B*57:01-associated HIV disease protection.

    IMPORTANCE HLA-B*57 is the HLA class I molecule that affords the greatest protection against disease progression in HIV infection. Understanding the key mechanism(s) underlying immunosuppression of HIV is of importance in guiding therapeutic and vaccine-related approaches to improve the levels of HIV control occurring in nature. Numerous mechanisms have been proposed to explain the HLA associations with differential HIV disease outcome, but no consensus exists. These studies focus on two subtypes of HLA-B*57 prevalent in Caucasian and African populations, HLA-B*57:01 and HLA-B*57:03, respectively. These alleles appear equally protective against HIV disease progression. The CTL epitopes presented are in many cases identical, and the dominant response in chronic infection in each case is to the Gag epitope KF11. However, there the similarity ends. This study sought to better understand the reasons for these differences and what they teach us about which immune responses contribute to immune control of HIV infection.

  • Identification of Novel, Highly Expressed Retroviral MicroRNAs in Cells Infected by Bovine Foamy Virus [Genome Replication and Regulation of Viral Gene Expression]

  • While numerous viral microRNAs (miRNAs) expressed by DNA viruses, especially herpesvirus family members, have been reported, there have been very few reports of miRNAs derived from RNA viruses. Here we describe three miRNAs expressed by bovine foamy virus (BFV), a member of the spumavirus subfamily of retroviruses, in both BFV-infected cultured cells and BFV-infected cattle. All three viral miRNAs are initially expressed in the form of an ~122-nucleotide (nt) pri-miRNA, encoded within the BFV long terminal repeat U3 region, that is subsequently cleaved to generate two pre-miRNAs that are then processed to yield three distinct, biologically active miRNAs. The BFV pri-miRNA is transcribed by RNA polymerase III, and the three resultant mature miRNAs were found to contribute a remarkable ~70% of all miRNAs expressed in BFV-infected cells. These data document the second example of a retrovirus that is able to express viral miRNAs by using embedded proviral RNA polymerase III promoters.

    IMPORTANCE Foamy viruses are a ubiquitous family of nonpathogenic retroviruses that have potential as gene therapy vectors in humans. Here we demonstrate that bovine foamy virus (BFV) expresses high levels of three viral microRNAs (miRNAs) in BFV-infected cells in culture and also in infected cattle. The BFV miRNAs are unusual in that they are initially transcribed by RNA polymerase III as a single, ~122-nt pri-miRNA that is subsequently processed to release three fully functional miRNAs. The observation that BFV, a foamy virus, is able to express viral miRNAs in infected cells adds to emerging evidence that miRNA expression is a common, albeit clearly not universal, property of retroviruses and suggests that these miRNAs may exert a significant effect on viral replication in vivo.

  • Ultrastructural Characterization and Three-Dimensional Architecture of Replication Sites in Dengue Virus-Infected Mosquito Cells [Structure and Assembly]

  • During dengue virus infection of host cells, intracellular membranes are rearranged into distinct subcellular structures such as double-membrane vesicles, convoluted membranes, and tubular structures. Recent electron tomographic studies have provided a detailed three-dimensional architecture of the double-membrane vesicles, representing the sites of dengue virus replication, but temporal and spatial evidence linking membrane morphogenesis with viral RNA synthesis is lacking. Integrating techniques in electron tomography and molecular virology, we defined an early period in virus-infected mosquito cells during which the formation of a virus-modified membrane structure, the double-membrane vesicle, is proportional to the rate of viral RNA synthesis. Convoluted membranes were absent in dengue virus-infected C6/36 cells. Electron tomographic reconstructions elucidated a high-resolution view of the replication complexes inside vesicles and allowed us to identify distinct pathways of particle formation. Hence, our findings extend the structural details of dengue virus replication within mosquito cells and highlight their differences from mammalian cells.

    IMPORTANCE Dengue virus induces several distinct intracellular membrane structures within the endoplasmic reticulum of mammalian cells. These structures, including double-membrane vesicles and convoluted membranes, are linked, respectively, with viral replication and viral protein processing. However, dengue virus cycles between two disparate animal groups with differing physiologies: mammals and mosquitoes. Using techniques in electron microscopy, we examined the differences between intracellular structures induced by dengue virus in mosquito cells. Additionally, we utilized techniques in molecular virology to temporally link events in virus replication to the formation of these dengue virus-induced membrane structures.

  • Enhancement of Blood-Brain Barrier Permeability and Reduction of Tight Junction Protein Expression Are Modulated by Chemokines/Cytokines Induced by Rabies Virus Infection [Pathogenesis and Immunity]

  • Infection with laboratory-attenuated rabies virus (RABV) enhances blood-brain barrier (BBB) permeability, which has been demonstrated to be an important factor for host survival, since it allows immune effectors to enter the central nervous system (CNS) and clear RABV. To probe the mechanism by which RABV infection enhances BBB permeability, the expression of tight junction (TJ) proteins in the CNS was investigated following intracranial inoculation with laboratory-attenuated or wild-type (wt) RABV. BBB permeability was significantly enhanced in mice infected with laboratory-attenuated, but not wt, RABV. The expression levels of TJ proteins (claudin-5, occludin, and zonula occludens-1) were decreased in mice infected with laboratory-attenuated, but not wt, RABV, suggesting that enhancement of BBB permeability is associated with the reduction of TJ protein expression in RABV infection. RABV neither infects the brain microvascular endothelial cells (BMECs) nor modulates the expression of TJ proteins in BMECs. However, brain extracts prepared from mice infected with laboratory-attenuated, but not wt, RABV reduced TJ protein expression in BMECs. It was found that brain extracts from mice infected with laboratory-attenuated RABV contained significantly higher levels of inflammatory chemokines/cytokines than those from mice infected with wt RABV. Pathway analysis indicates that gamma interferon (IFN-) is located in the center of the cytokine network in the RABV-infected mouse brain, and neutralization of IFN- reduced both the disruption of BBB permeability in vivo and the downregulation of TJ protein expression in vitro. These findings indicate that the enhancement of BBB permeability and the reduction of TJ protein expression are due not to RABV infection per se but to virus-induced inflammatory chemokines/cytokines.

    IMPORTANCE Previous studies have shown that infection with only laboratory-attenuated, not wild-type, rabies virus (RABV) enhances blood-brain barrier (BBB) permeability, allowing immune effectors to enter the central nervous system (CNS) and clear RABV from the CNS. This study investigated the mechanism by which RABV infection enhances BBB permeability. It was found that RABV infection enhances BBB permeability by downregulation of tight junction (TJ) protein expression in the brain microvasculature. It was further found that it is not RABV infection per se but the chemokines/cytokines induced by RABV infection that downregulate the expression of TJ proteins and enhance BBB permeability. Blocking some of these cytokines, such as IFN-, ameliorated both the disruption of BBB permeability and the downregulation of TJ protein expression. These studies may provide a foundation for developing therapeutics for clinical rabies, such as medication that could be used to enhance BBB permeability.

  • 17{beta}-Estradiol Protects Females against Influenza by Recruiting Neutrophils and Increasing Virus-Specific CD8 T Cell Responses in the Lungs [Pathogenesis and Immunity]

  • 17bbeta;-Estradiol (E2) treatment limits the pathology associated with pulmonary diseases caused by pathogens, allergens, and asthma, partly by reducing the production of proinflammatory cytokines and chemokines. To test the hypothesis that E2 protects against influenza A virus (IAV) infection by altering the recruitment and activity of innate immune cells and T cells, chemokine concentrations were measured and innate and adaptive immune cells were enumerated from the lungs of E2- and placebo-treated ovariectomized female C57BL/6 mice following infection. Females treated with E2 experienced less morbidity but had similar lung virus titers to placebo-treated females. Females treated with E2 had lower induction of CCL2 but higher CCL3 and CXCL1 responses in their lungs than placebo-treated females. Pulmonary recruitment of neutrophils, NK cells, macrophages, and dendritic cells was increased following infection, but only neutrophil numbers were greater in E2-treated than placebo-treated females. Neutrophils enhance the responses of influenza virus-specific CD8 T cells to promote virus clearance and improve the outcome of infection. Total numbers of virus-specific CD8 T cells were not altered by treatment with E2, but the proportion of gamma interferon (IFN-)- and tumor necrosis factor alpha (TNF-aalpha;)-producing, virus-specific CD8 T cells was increased. Neutrophil depletion in E2-treated females increased morbidity, reduced pulmonary production of chemoattractants for neutrophils, and reduced IFN- production by virus-specific CD8 T cells. Neutrophils mediate both inflammation and tissue repair during IAV infection and are regulated by E2 to improve the outcome of influenza in females.

    IMPORTANCE Severe influenza is associated with excessive inflammation that leads to tissue damage. We demonstrate that estradiol (E2) is a potent anti-inflammatory hormone that reduces the severity of influenza A virus infection in females. Treatment of female C57BL/6 mice with E2 does not affect virus replication but rather alters the production of chemokines, pulmonary recruitment of neutrophils, and the cytokine responses of virus-specific CD8 T cells to protect females against severe influenza.

  • Adenovirus-Based Vaccines against Rhesus Lymphocryptovirus EBNA-1 Induce Expansion of Specific CD8+ and CD4+ T Cells in Persistently Infected Rhesus Macaques [Vaccines and Antiviral Agents]

  • The impact of Epstein-Barr virus (EBV) on human health is substantial, but vaccines that prevent primary EBV infections or treat EBV-associated diseases are not yet available. The Epstein-Barr nuclear antigen 1 (EBNA-1) is an important target for vaccination because it is the only protein expressed in all EBV-associated malignancies. We have designed and tested two therapeutic EBV vaccines that target the rhesus (rh) lymphocryptovirus (LCV) EBNA-1 to determine if ongoing T cell responses during persistent rhLCV infection in rhesus macaques can be expanded upon vaccination. Vaccines were based on two serotypes of E1-deleted simian adenovirus and were administered in a prime-boost regimen. To further modulate the response, rhEBNA-1 was fused to herpes simplex virus glycoprotein D (HSV-gD), which acts to block an inhibitory signaling pathway during T cell activation. We found that vaccines expressing rhEBNA-1 with or without functional HSV-gD led to expansion of rhEBNA-1-specific CD8+ and CD4+ T cells in 33% and 83% of the vaccinated animals, respectively. Additional animals developed significant changes within T cell subsets without changes in total numbers. Vaccination did not increase T cell responses to rhBZLF-1, an immediate early lytic phase antigen of rhLCV, thus indicating that increases of rhEBNA-1-specific responses were a direct result of vaccination. Vaccine-induced rhEBNA-1-specific T cells were highly functional and produced various combinations of cytokines as well as the cytolytic molecule granzyme B. These results serve as an important proof of principle that functional EBNA-1-specific T cells can be expanded by vaccination.

    IMPORTANCE EBV is a common human pathogen that establishes a persistent infection through latency in B cells, where it occasionally reactivates. EBV infection is typically benign and is well controlled by the host adaptive immune system; however, it is considered carcinogenic due to its strong association with lymphoid and epithelial cell malignancies. Latent EBNA-1 is a promising target for a therapeutic vaccine, as it is the only antigen expressed in all EBV-associated malignancies. The goal was to determine if rhEBNA-1-specific T cells could be expanded upon vaccination of infected animals. Results were obtained with vaccines that target EBNA-1 of rhLCV, a virus closely related to EBV. We found that vaccination led to expansion of rhEBNA-1 immune cells that exhibited functions fit for controlling viral infection. This confirms that rhEBNA-1 is a suitable target for therapeutic vaccines. Future work should aim to generate more-robust T cell responses through modified vaccines.

  • A Host-Oriented Inhibitor of Junin Argentine Hemorrhagic Fever Virus Egress [Vaccines and Antiviral Agents]

  • There are currently no U.S. Food and Drug Administration (FDA)-approved vaccines or therapeutics to prevent or treat Argentine hemorrhagic fever (AHF). The causative agent of AHF is Junin virus (JUNV); a New World arenavirus classified as a National Institute of Allergy and Infectious Disease/Centers for Disease Control and Prevention category A priority pathogen. The PTAP late (L) domain motif within JUNV Z protein facilitates virion egress and transmission by recruiting host Tsg101 and other ESCRT complex proteins to promote scission of the virus particle from the plasma membrane. Here, we describe a novel compound (compound 0013) that blocks the JUNV Z-Tsg101 interaction and inhibits budding of virus-like particles (VLPs) driven by ectopic expression of the Z protein and live-attenuated JUNV Candid-1 strain in cell culture. Since inhibition of the PTAP-Tsg101 interaction inhibits JUNV egress, compound 0013 serves as a prototype therapeutic that could reduce virus dissemination and disease progression in infected individuals. Moreover, since PTAP l-domain-mediated Tsg101 recruitment is utilized by other RNA virus pathogens (e.g., Ebola virus and HIV-1), PTAP inhibitors such as compound 0013 have the potential to function as potent broad-spectrum, host-oriented antiviral drugs.

    IMPORTANCE There are currently no FDA-approved vaccines or therapeutics to prevent or treat Argentine hemorrhagic fever (AHF). The causative agent of AHF is Junin virus (JUNV); a New World arenavirus classified as an NIAID/CDC category A priority pathogen. Here, we describe a prototype therapeutic that blocks budding of JUNV and has the potential to function as a broad-spectrum antiviral drug.

  • TMPRSS2 Is a Host Factor That Is Essential for Pneumotropism and Pathogenicity of H7N9 Influenza A Virus in Mice [Pathogenesis and Immunity]

  • Cleavage of the hemagglutinin (HA) by host proteases is essential for the infectivity of influenza viruses. Here, we analyzed the role of the serine protease TMPRSS2, which activates HA in the human respiratory tract, in pathogenesis in a mouse model. Replication of the human H7N9 isolate A/Anhui/1/13 and of human H1N1 and H3N2 viruses was compared in TMPRSS2 knockout (TMPRSS2nndash;/nndash;) and wild-type (WT) mice. Knockout of TMPRSS2 expression inhibited H7N9 influenza virus replication in explants of murine tracheas, bronchi, and lungs. H1N1 virus replication was also strongly suppressed in airway explants of TMPRSS2nndash;/nndash; mice, while H3N2 virus replication was only marginally affected. H7N9 and H1N1 viruses were apathogenic in TMPRSS2nndash;/nndash; mice, whereas WT mice developed severe disease with mortality rates of 100% and 20%, respectively. In contrast, all H3N2 infected TMPRSS2nndash;/nndash; and WT mice succumbed to lethal infection. Cleavage analysis showed that H7 and H1 are efficiently activated by TMPRSS2, whereas H3 is less susceptible to the protease. Our data demonstrate that TMPRSS2 is a host factor that is essential for pneumotropism and pathogenicity of H7N9 and H1N1 influenza virus in mice. In contrast, replication of H3N2 virus appears to depend on another, not yet identified protease, supporting the concept that human influenza viruses differ in protease specificity.

    IMPORTANCE Cleavage of the hemagglutinin (HA) by host proteases is essential for the infectivity of influenza virus, but little is known about its relevance for pathogenesis in mammals. Here, we show that knockout mice that do not express the HA-activating protease TMPRSS2 are resistant to pulmonary disease with lethal outcome when infected with influenza A viruses of subtypes H7N9 and H1N1, whereas they are not protected from lethal H3N2 virus infection. These findings demonstrate that human influenza viruses differ in protease specificity, and that expression of the appropriate protease in respiratory tissues is essential for pneumotropism and pathogenicity. Our observations also demonstrate that HA-activating proteases and in particular TMPRSS2 are promising targets for influenza therapy.

  • Substitutions near the Hemagglutinin Receptor-Binding Site Determine the Antigenic Evolution of Influenza A H3N2 Viruses in U.S. Swine [Genetic Diversity and Evolution]

  • Swine influenza A virus is an endemic and economically important pathogen in pigs, with the potential to infect other host species. The hemagglutinin (HA) protein is the primary target of protective immune responses and the major component in swine influenza A vaccines. However, as a result of antigenic drift, vaccine strains must be regularly updated to reflect currently circulating strains. Characterizing the cross-reactivity between strains in pigs and seasonal influenza virus strains in humans is also important in assessing the relative risk of interspecies transmission of viruses from one host population to the other. Hemagglutination inhibition (HI) assay data for swine and human H3N2 viruses were used with antigenic cartography to quantify the antigenic differences among H3N2 viruses isolated from pigs in the United States from 1998 to 2013 and the relative cross-reactivity between these viruses and current human seasonal influenza A virus strains. Two primary antigenic clusters were found circulating in the pig population, but with enough diversity within and between the clusters to suggest updates in vaccine strains are needed. We identified single amino acid substitutions that are likely responsible for antigenic differences between the two primary antigenic clusters and between each antigenic cluster and outliers. The antigenic distance between current seasonal influenza virus H3 strains in humans and those endemic in swine suggests that population immunity may not prevent the introduction of human viruses into pigs, and possibly vice versa, reinforcing the need to monitor and prepare for potential incursions.

    IMPORTANCE Influenza A virus (IAV) is an important pathogen in pigs and humans. The hemagglutinin (HA) protein is the primary target of protective immune responses and the major target of vaccines. However, vaccine strains must be updated to reflect current strains. Characterizing the differences between seasonal IAV in humans and swine IAV is important in assessing the relative risk of interspecies transmission of viruses. We found two primary antigenic clusters of H3N2 in the U.S. pig population, with enough diversity to suggest updates in swine vaccine strains are needed. We identified changes in the HA protein that are likely responsible for these differences and that may be useful in predicting when vaccines need to be updated. The difference between human H3N2 viruses and those in swine is enough that population immunity is unlikely to prevent new introductions of human IAV into pigs or vice versa, reinforcing the need to monitor and prepare for potential introductions.

  • Host-Specific Adaptation of HIV-1 Subtype B in the Japanese Population [Pathogenesis and Immunity]

  • The extent to which HIV-1 clade B strains exhibit population-specific adaptations to host HLA alleles remains incompletely known, in part due to incomplete characterization of HLA-associated HIV-1 polymorphisms (HLA-APs) in different global populations. Moreover, it remains unknown to what extent the same HLA alleles may drive significantly different escape pathways across populations. As the Japanese population exhibits distinctive HLA class I allele distributions, comparative analysis of HLA-APs between HIV-1 clade B-infected Japanese and non-Asian cohorts could shed light on these questions. However, HLA-APs remain incompletely mapped in Japan. In a cohort of 430 treatment-naive Japanese with chronic HIV-1 clade B infection, we identified 284 HLA-APs in Gag, Pol, and Nef using phylogenetically corrected methods. The number of HLA-associated substitutions in Pol, notably those restricted by HLA-B*52:01, was weakly inversely correlated with the plasma viral load (pVL), suggesting that the transmission and persistence of B*52:01-driven Pol mutations could modulate the pVL. Differential selection of HLA-APs between HLA subtype members, including those differing only with respect to substitutions outside the peptide-binding groove, was observed, meriting further investigation as to their mechanisms of selection. Notably, two-thirds of HLA-APs identified in Japan had not been reported in previous studies of predominantly Caucasian cohorts and were attributable to HLA alleles unique to, or enriched in, Japan. We also identified 71 cases where the same HLA allele drove significantly different escape pathways in Japan versus predominantly Caucasian cohorts. Our results underscore the distinct global evolution of HIV-1 clade B as a result of host population-specific cellular immune pressures.

    IMPORTANCE Cytotoxic T lymphocyte (CTL) escape mutations in HIV-1 are broadly predictable based on the HLA class I alleles expressed by the host. Because HLA allele distributions differ among worldwide populations, the pattern and diversity of HLA-associated escape mutations are likely to be somewhat distinct to each race and region. HLA-associated polymorphisms (HLA-APs) in HIV-1 have previously been identified at the population level in European, North American, Australian, and African cohorts; however, large-scale analyses of HIV-1 clade B-specific HLA-APs in Asians are lacking. Differential intraclade HIV-1 adaptation to global populations can be investigated via comparative analyses of HLA-associated polymorphisms across ethnic groups, but such studies are rare. Here, we identify HLA-APs in a large Japanese HIV-1 clade B cohort using phylogenetically informed methods and observe that the majority of them had not been previously characterized in predominantly Caucasian populations. The results highlight HIV's unique adaptation to cellular immune pressures imposed by different global populations.

  • Differential Properties of Cytomegalovirus pUL97 Kinase Isoforms Affect Viral Replication and Maribavir Susceptibility [Pathogenesis and Immunity]

  • The human cytomegalovirus (HCMV)-encoded kinase pUL97 is required for efficient viral replication. Previous studies described two isoforms of pUL97, the full-length isoform (M1) and a smaller isoform likely resulting from translation initiation at codon 74 (M74). Here, we report the detection of a third pUL97 isoform during viral infection resulting from translation initiation at codon 157 (isoform M157). The consistent expression of isoform M157 as a minor component of pUL97 during infection with clinical and laboratory-adapted HCMV strains was suppressed when codon 157 was mutagenized. Viral mutants expressing specific isoforms were generated to compare their growth and drug susceptibility phenotypes, as well as pUL97 intracellular localization patterns and kinase activities. The exclusive expression of isoform M157 resulted in substantially reduced viral growth and resistance to the pUL97 inhibitor maribavir while retaining susceptibility to ganciclovir. Confocal imaging demonstrated reduced nuclear import of amino-terminal deletion isoforms compared to isoform M1. Isoform M157 showed reduced efficiency of various substrate protein interactions and autophosphorylation, whereas Rb phosphorylation was preserved. These results reveal differential properties of pUL97 isoforms that affect viral replication, with implications for the antiviral efficacy of maribavir.

    IMPORTANCE The HCMV UL97 kinase performs important functions in viral replication that are targeted by the antiviral drug maribavir. Here, we describe a naturally occurring short isoform of the kinase that when expressed by itself in a recombinant virus results in altered intracellular localization, impaired growth, and high-level resistance to maribavir compared to those of the predominant full-length counterpart. This is another factor to consider in explaining why maribavir appears to have variable antiviral activity in cell culture and in vivo.

  • Human Papillomavirus Community in Healthy Persons, Defined by Metagenomics Analysis of Human Microbiome Project Shotgun Sequencing Data Sets [Structure and Assembly]

  • Human papillomavirus (HPV) causes a number of neoplastic diseases in humans. Here, we show a complex normal HPV community in a cohort of 103 healthy human subjects, by metagenomics analysis of the shotgun sequencing data generated from the NIH Human Microbiome Project. The overall HPV prevalence was 68.9% and was highest in the skin (61.3%), followed by the vagina (41.5%), mouth (30%), and gut (17.3%). Of the 109 HPV types as well as additional unclassified types detected, most were undetectable by the widely used commercial kits targeting the vaginal/cervical HPV types. These HPVs likely represent true HPV infections rather than transitory exposure because of strong organ tropism and persistence of the same HPV types in repeat samples. Coexistence of multiple HPV types was found in 48.1% of the HPV-positive samples. Networking between HPV types, cooccurrence or exclusion, was detected in vaginal and skin samples. Large contigs assembled from short HPV reads were obtained from several samples, confirming their genuine HPV origin. This first large-scale survey of HPV using a shotgun sequencing approach yielded a comprehensive map of HPV infections among different body sites of healthy human subjects.

    IMPORTANCE This nonbiased survey indicates that the HPV community in healthy humans is much more complex than previously defined by widely used kits that are target selective for only a few high- and low-risk HPV types for cervical cancer. The importance of nononcogenic viruses in a mixed HPV infection could be for stimulating or inhibiting a coexisting oncogenic virus via viral interference or immune cross-reaction. Knowledge gained from this study will be helpful to guide the designing of epidemiological and clinical studies in the future to determine the impact of nononcogenic HPV types on the outcome of HPV infections.

  • MicroRNA 155 Regulates Japanese Encephalitis Virus-Induced Inflammatory Response by Targeting Src Homology 2-Containing Inositol Phosphatase 1 [Cellular Response to Infection]

  • MicroRNAs (miRNAs) are single-stranded small RNA molecules that regulate various cellular processes. miRNA 155 (miR-155) regulates various aspects of innate and adaptive immune responses and plays a key role in various viral infections and the resulting neuroinflammation. The present study evaluated the involvement of miR-155 in modulating Japanese encephalitis virus (JEV)-induced neuroinflammation. We observed that miR-155 expression was upregulated during JEV infection of mouse primary microglia, the BV-2 microglia cell line, and in both mouse and human brains. In vitro and in vivo knockdown of miR-155 minimized JEV-induced inflammatory responses. In the present study, we confirmed targeting of the Src homology 2-containing inositol phosphatase 1 (SHIP1) 3' untranslated region (UTR) by miR-155 in the context of JEV infection. Inhibition of SHIP1 by miR-155 resulted in higher beta interferon (IFN-bbeta;) and proinflammatory cytokine production through activation of TANK-binding kinase 1 (TBK-1). Based on these observations, we conclude that miR-155 modulates the neuroinflammatory response during JEV infection via negative regulation of SHIP1 expression. Thus, modulation of miR-155 could be a novel strategy to regulate JEV-induced neuroinflammation.

    IMPORTANCE Japanese encephalitis virus (JEV), a member of the family Flaviviridae that causes Japanese encephalitis (JE), is the most common mosquito-borne encephalitis virus in the Asia-Pacific region. The disease is feared, as currently there are no specific antiviral drugs available. JEV targets the central nervous system, leading to high mortality and neurological and psychiatric sequelae in some of those who survive. The level of inflammation correlates well with the clinical outcome in patients. Recently, microRNA (miRNA), a single-stranded noncoding RNA, has been implicated in various brain disorders. The present study investigates the role of miRNA in JEV-induced neuroinflammation. Our results show that miRNA 155 (miR-155) targets the Src homology 2-containing inositol phosphatase 1 (SHIP1) protein and promotes inflammation by regulating the NF-B pathway, increasing the expression of various proinflammatory cytokines and the antiviral response. Thus, miR-155 is a potential therapeutic target to develop antivirals in JE and other brain disorders where inflammation plays a significant role in disease progression.

  • Epstein-Barr Virus Utilizes Ikaros in Regulating Its Latent-Lytic Switch in B Cells [Genome Replication and Regulation of Viral Gene Expression]

  • Ikaros is a zinc finger DNA-binding protein that regulates chromatin remodeling and the expression of genes involved in the cell cycle, apoptosis, and Notch signaling. It is a master regulator of lymphocyte differentiation and functions as a tumor suppressor in acute lymphoblastic leukemia. Nevertheless, no previous reports described effects of Ikaros on the life cycle of any human lymphotropic virus. Here, we demonstrate that full-length Ikaros (IK-1) functions as a major factor in the maintenance of viral latency in Epstein-Barr virus (EBV)-positive Burkitt's lymphoma Sal and MutuI cell lines. Either silencing of Ikaros expression by small hairpin RNA (shRNA) knockdown or ectopic expression of a non-DNA-binding isoform induced lytic gene expression. These effects synergized with other lytic inducers of EBV, including transforming growth factor bbeta; (TGF-bbeta;) and the hypoxia mimic desferrioxamine. Data from chromatin immunoprecipitation (ChIP)-quantitative PCR (qPCR) and ChIP-sequencing (ChIP-seq) analyses indicated that Ikaros did not bind to either of the EBV immediate early genes BZLF1 and BRLF1. Rather, Ikaros affected the expression of Oct-2 and Bcl-6, other transcription factors that directly inhibit EBV reactivation and plasma cell differentiation, respectively. IK-1 also complexed with the EBV immediate early R protein in coimmunoprecipitation assays and partially colocalized with R within cells. The presence of R alleviated IK-1-mediated transcriptional repression, with IK-1 then cooperating with Z and R to enhance lytic gene expression. Thus, we conclude that Ikaros plays distinct roles at different stages of EBV's life cycle: it contributes to maintaining latency via indirect mechanisms, and it may also synergize with Z and R to enhance lytic replication through direct association with R and/or R-induced alterations in Ikaros' functional activities via cellular signaling pathways.

    IMPORTANCE This is the first report showing that the cellular protein Ikaros, a known master regulator of hematopoiesis and critical tumor suppressor in acute lymphoblastic leukemia, also plays important roles in the life cycle of Epstein-Barr virus in B cells.

  • Structural Stability of Influenza A(H1N1)pdm09 Virus Hemagglutinins [Structure and Assembly]

  • The noncovalent interactions that mediate trimerization of the influenza hemagglutinin (HA) are important determinants of its biological activities. Recent studies have demonstrated that mutations in the HA trimer interface affect the thermal and pH sensitivities of HA, suggesting a possible impact on vaccine stability (). We used size exclusion chromatography analysis of recombinant HA ectodomain to compare the differences among recombinant trimeric HA proteins from early 2009 pandemic H1N1 viruses, which dissociate to monomers, with those of more recent virus HAs that can be expressed as trimers. We analyzed differences among the HA sequences and identified intermolecular interactions mediated by the residue at position 374 (HA0 numbering) of the HA2 subdomain as critical for HA trimer stability. Crystallographic analyses of HA from the recent H1N1 virus A/Washington/5/2011 highlight the structural basis for this observed phenotype. It remains to be seen whether more recent viruses with this mutation will yield more stable vaccines in the future.

    IMPORTANCE Hemagglutinins from the early 2009 H1N1 pandemic viruses are unable to maintain a trimeric complex when expressed in a recombinant system. However, HAs from 2010 and 2011 strains are more stable, and our work highlights that the improvement in stability can be attributed to an E374K substitution in the HA2 subunit of the stalk that emerged naturally in the circulating viruses.

  • CBF{beta} Enhances De Novo Protein Biosynthesis of Its Binding Partners HIV-1 Vif and RUNX1 and Potentiates the Vif-Induced Degradation of APOBEC3G [Virus-Cell Interactions]

  • Vif is a lentiviral accessory protein that regulates viral infectivity in part by inducing proteasomal degradation of APOBEC3G (A3G). Recently, CBFbbeta; was found to facilitate Vif-dependent degradation of A3G. However, the exact role of CBFbbeta; remains unclear. Several studies noted reduced Vif expression in CBFbbeta; knockdown cells while others saw no significant impact of CBFbbeta; on Vif stability. Here, we confirmed that CBFbbeta; increases Vif steady-state levels. CBFbbeta; affected expression of neither viral Gag nor Vpu protein, indicating that CBFbbeta; regulates Vif expression posttranscriptionally. Kinetic studies revealed effects of CBFbbeta; on both metabolic stability and the rate of Vif biosynthesis. These effects were dependent on the ability of CBFbbeta; to interact with Vif. Importantly, at comparable Vif levels, CBFbbeta; further enhanced A3G degradation, suggesting that CBFbbeta; facilitates A3G degradation by increasing the levels of Vif and by independently augmenting the ability of Vif to target A3G for degradation. CBFbbeta; also increased expression of RUNX1 by enhancing RUNX1 biosynthesis. Unlike Vif, however, CBFbbeta; had no detectable effect on RUNX1 metabolic stability. We propose that CBFbbeta; acts as a chaperone to stabilize Vif during and after synthesis and to facilitate interaction of Vif with cellular cofactors required for the efficient degradation of A3G.

    IMPORTANCE In this study, we show that CBFbbeta; has a profound effect on the expression of the HIV-1 infectivity factor Vif and the cellular transcription factor RUNX1, two proteins that physically interact with CBFbbeta;. Kinetic studies revealed that CBFbbeta; increases the rate of Vif and RUNX1 biosynthesis at the level of translation. Mutants of Vif unable to physically interact with CBFbbeta; were nonresponsive to CBFbbeta;. Our data suggest that CBFbbeta; exerts a chaperone-like activity (i) to minimize the production of defective ribosomal products (DRiPs) by binding to nascent protein to prevent premature termination and (ii) to stabilize mature protein conformation to ensure proper function of Vif and RUNX1. Thus, we identified a novel mechanism of protein regulation that affects both viral and cellular factors and thus has broad implications beyond the immediate HIV field.

  • Ectromelia Virus Encodes a BTB/kelch Protein, EVM150, That Inhibits NF-{kappa}B Signaling [Virus-Cell Interactions]

  • The NF-B signaling pathway plays a critical role in inflammation and innate immunity. Consequently, many viruses have evolved strategies to inhibit NF-B in order to facilitate replication and evasion of the host immune response. Recently, we determined that ectromelia virus, the causative agent of mousepox, contains a family of four BTB/kelch proteins that interact with cullin-3-based ubiquitin ligases. We demonstrate here that expression of EVM150, one of the four BTB/kelch proteins, inhibited NF-B activation induced by tumor necrosis factor alpha (TNF-aalpha;) and interleukin-1bbeta; (IL-1bbeta;). Although EVM150 inhibited NF-B p65 nuclear translocation, IBaalpha; degradation was observed, indicating that EVM150 functioned downstream of IBaalpha; degradation. Significantly, expression of the BTB-only domain of EVM150 blocked NF-B activation, demonstrating that EVM150 functioned independently of the kelch domain and its role as an adapter for cullin-3-based ubiquitin ligases. Furthermore, cullin-3 knockdown by small interfering RNA demonstrated that cullin-3-based ubiquitin ligases are dispensable for TNF-aalpha;-induced NF-B activation. Interestingly, nuclear translocation of IRF3 and STAT1 still occurred in the presence of EVM150, indicating that EVM150 prevented NF-B nuclear translocation specifically. In addition to identifying EVM150 as an inhibitor of the NF-B pathway, this study provides new insights into the role of BTB/kelch proteins during virus infection.

    IMPORTANCE With the exception of virulence studies, little work has been done to determine the role of poxviral BTB/kelch proteins during infection. This study, for the first time, has identified a mechanism for the ectromelia virus BTB/kelch protein EVM150. Here, we show that EVM150 is a novel inhibitor of the cellular NF-B pathway, an important component of the antiviral response. This study adds EVM150 to the growing list of NF-B inhibitors in poxviruses and provides new insights into the role of BTB/kelch proteins during virus infection.

  • Middle East Respiratory Syndrome Coronavirus 4a Protein Is a Double-Stranded RNA-Binding Protein That Suppresses PACT-Induced Activation of RIG-I and MDA5 in the Innate Antiviral Response [Virus-Cell Interactions]

  • Middle East respiratory syndrome coronavirus (MERS-CoV) is an emerging pathogen that causes severe disease in human. MERS-CoV is closely related to bat coronaviruses HKU4 and HKU5. Evasion of the innate antiviral response might contribute significantly to MERS-CoV pathogenesis, but the mechanism is poorly understood. In this study, we characterized MERS-CoV 4a protein as a novel immunosuppressive factor that antagonizes type I interferon production. MERS-CoV 4a protein contains a double-stranded RNA-binding domain capable of interacting with poly(Immiddot;C). Expression of MERS-CoV 4a protein suppressed the interferon production induced by poly(Immiddot;C) or Sendai virus. RNA binding of MERS-CoV 4a protein was required for IFN antagonism, a property shared by 4a protein of bat coronavirus HKU5 but not by the counterpart in bat coronavirus HKU4. MERS-CoV 4a protein interacted with PACT in an RNA-dependent manner but not with RIG-I or MDA5. It inhibited PACT-induced activation of RIG-I and MDA5 but did not affect the activity of downstream effectors such as RIG-I, MDA5, MAVS, TBK1, and IRF3. Taken together, our findings suggest a new mechanism through which MERS-CoV employs a viral double-stranded RNA-binding protein to circumvent the innate antiviral response by perturbing the function of cellular double-stranded RNA-binding protein PACT. PACT targeting might be a common strategy used by different viruses, including Ebola virus and herpes simplex virus 1, to counteract innate immunity.

    IMPORTANCE Middle East respiratory syndrome coronavirus (MERS-CoV) is an emerging and highly lethal human pathogen. Why MERS-CoV causes severe disease in human is unclear, and one possibility is that MERS-CoV is particularly efficient in counteracting host immunity, including the sensing of virus invasion. It will therefore be critical to clarify how MERS-CoV cripples the host proteins that sense viruses and to compare MERS-CoV with its ancestral viruses in bats in the counteraction of virus sensing. This work not only provides a new understanding of the abilities of MERS-CoV and closely related bat viruses to subvert virus sensing but also might prove useful in revealing new strategies for the development of vaccines and antivirals.

  • Identification of Amino Acid Changes That May Have Been Critical for the Genesis of A(H7N9) Influenza Viruses [Genetic Diversity and Evolution]

  • Novel influenza A viruses of the H7N9 subtype [A(H7N9)] emerged in the spring of 2013 in China and had infected 163 people as of 10 January 2014; 50 of them died of the severe respiratory infection caused by these viruses. Phylogenetic studies have indicated that the novel A(H7N9) viruses emerged from reassortment of H7, N9, and H9N2 viruses. Inspections of protein sequences from A(H7N9) viruses and their immediate predecessors revealed several amino acid changes in A(H7N9) viruses that may have facilitated transmission and replication in the novel host. Since mutations that occurred more ancestrally may also have contributed to the genesis of A(H7N9) viruses, we inferred historical evolutionary events leading to the novel viruses. We identified a number of amino acid changes on the evolutionary path to A(H7N9) viruses, including substitutions that may be associated with host range, replicative ability, and/or host responses to infection. The biological significance of these amino acid changes can be tested in future studies.

    IMPORTANCE The novel influenza A viruses of the H7N9 subtype [A(H7N9)], which first emerged in the spring of 2013, cause severe respiratory infections in humans. Here, we performed a comprehensive evolutionary analysis of the progenitors of A(H7N9) viruses to identify amino acid changes that may have been critical for the emergence of A(H7N9) viruses and their ability to infect humans. We provide a list of potentially important amino acid changes that can be tested for their significance for the influenza virus host range, replicative ability, and/or host responses to infection.

  • VSV-GP: a Potent Viral Vaccine Vector That Boosts the Immune Response upon Repeated Applications [Vaccines and Antiviral Agents]

  • Antivector immunity limits the response to homologous boosting for viral vector vaccines. Here, we describe a new, potent vaccine vector based on replication-competent vesicular stomatitis virus pseudotyped with the glycoprotein of the lymphocytic choriomeningitis virus (VSV-GP), which we previously showed to be safe in mice. In mice, VSV and VSV-GP encoding ovalbumin (OVA) as a model antigen (VSV-OVA and VSV-GP-OVA) induced equal levels of OVA-specific humoral and cellular immune responses upon a single immunization. However, boosting with the same vector was possible only for VSV-GP-OVA as neutralizing antibodies to VSV limited the immunogenicity of the VSV-OVA boost. OVA-specific cytotoxic T-lymphocyte (CTL) responses induced by VSV-GP-OVA were at least as potent as those induced by an adenoviral state-of-the-art vaccine vector and completely protected mice in a Listeria monocytogenes challenge model. VSV-GP is so far the only replication-competent vaccine vector that does not lose efficacy upon repeated application.

    IMPORTANCE Although there has been great progress in treatment and prevention of infectious diseases in the past several years, effective vaccines against some of the most serious infections, e.g., AIDS, malaria, hepatitis C, or tuberculosis, are urgently needed. Here, several approaches based on viral vector vaccines are under development. However, for all viral vaccine vectors currently in clinical testing, repeated application is limited by neutralizing antibodies to the vector itself. Here, we have exploited the potential of vesicular stomatitis virus pseudotyped with the glycoprotein of the lymphocytic choriomeningitis virus (VSV-GP) as a vaccine platform. VSV-GP is the first replication-competent viral vector vaccine that does not induce vector-specific humoral immunity, i.e., neutralizing antibodies, and therefore can boost immune responses against a foreign antigen by repeated applications. The vector allows introduction of various antigens and therefore can serve as a platform technology for the development of novel vaccines against a broad spectrum of diseases.

  • 3Cpro of Foot-and-Mouth Disease Virus Antagonizes the Interferon Signaling Pathway by Blocking STAT1/STAT2 Nuclear Translocation [Virus-Cell Interactions]

  • Foot-and-mouth disease virus (FMDV) causes a highly contagious, debilitating disease in cloven-hoofed animals with devastating economic consequences. To survive in the host, FMDV has evolved to antagonize the host type I interferon (IFN) response. Previous studies have reported that the leader proteinase (Lpro) and 3Cpro of FMDV are involved in the inhibition of type I IFN production. However, whether the proteins of FMDV can inhibit type I IFN signaling is less well understood. In this study, we first found that 3Cpro of FMDV functioned to interfere with the JAK-STAT signaling pathway. Expression of 3Cpro significantly reduced the transcript levels of IFN-stimulated genes (ISGs) and IFN-stimulated response element (ISRE) promoter activity. The protein level, tyrosine phosphorylation of STAT1 and STAT2, and their heterodimerization were not affected. However, the nuclear translocation of STAT1/STAT2 was blocked by the 3Cpro protein. Further mechanistic studies demonstrated that 3Cpro induced proteasome- and caspase-independent protein degradation of karyopherin aalpha;1 (KPNA1), the nuclear localization signal receptor for tyrosine-phosphorylated STAT1, but not karyopherin aalpha;2, aalpha;3, or aalpha;4. Finally, we showed that the protease activity of 3Cpro contributed to the degradation of KPNA1 and thus blocked STAT1/STAT2 nuclear translocation. Taken together, results of our experiments describe for the first time a novel mechanism by which FMDV evolves to inhibit IFN signaling and counteract host innate antiviral responses.

    IMPORTANCE We show that 3Cpro of FMDV antagonizes the JAK-STAT signaling pathway by blocking STAT1/STAT2 nuclear translocation. Furthermore, 3Cpro induces KPNA1 degradation, which is independent of proteasome and caspase pathways. The protease activity of 3Cpro contributes to the degradation of KPNA1 and governs the ability of 3Cpro to inhibit the JAK-STAT signaling pathway. This study uncovers a novel mechanism evolved by FMDV to antagonize host innate immune responses.

  • Virologic and Immunologic Evidence of Multifocal Genital Herpes Simplex Virus 2 Infection [Pathogenesis and Immunity]

  • Genital herpes simplex virus (HSV) reactivation is thought to be anatomically and temporally localized, coincident with limited ganglionic infection. Short, subclinical shedding episodes are the most common form of HSV-2 reactivation, with host clearance mechanisms leading to rapid containment. The anatomic distribution of shedding episodes has not been characterized. To precisely define patterns of anatomic reactivation, we divided the genital tract into a 22-region grid and obtained daily swabs for 20 days from each region in 28 immunocompetent, HSV-2-seropositive persons. HSV was detected via PCR, and sites of asymptomatic HSV shedding were subjected to a biopsy procedure within 24 h. CD4+ and CD8+ T cells were quantified by immunofluorescence, and HSV-specific CD4+ T cells were identified by intracellular cytokine cytometry. HSV was detected in 868 (7%) of 11,603 genital swabs at a median of 12 sites per person (range, 0 to 22). Bilateral HSV detection occurred on 83 (67%) days with shedding, and the median quantity of virus detected/day was associated with the number of sites positive (P llt; 0.001). In biopsy specimens of asymptomatic shedding sites, we found increased numbers of CD8+ T cells compared to control tissue (27 versus 13 cells/mm2, P = 0.03) and identified HSV-specific CD4+ T cells. HSV reactivations emanate from widely separated anatomic regions of the genital tract and are associated with a localized cellular infiltrate that was demonstrated to be HSV specific in 3 cases. These data provide evidence that asymptomatic HSV-2 shedding contributes to chronic inflammation throughout the genital tract.

    IMPORTANCE This detailed report of the anatomic patterns of genital HSV-2 shedding demonstrates that HSV-2 reactivation can be detected at multiple bilateral sites in the genital tract, suggesting that HSV establishes latency throughout the sacral ganglia. In addition, genital biopsy specimens from sites of asymptomatic HSV shedding have increased numbers of CD8+ T cells compared to control tissue, and HSV-specific CD4+ T cells are found at sites of asymptomatic shedding. These findings suggest that widespread asymptomatic genital HSV-2 shedding is associated with a targeted host immune response and contributes to chronic inflammation throughout the genital tract.

  • Autonomous Parvoviruses neither Stimulate nor Are Inhibited by the Type I Interferon Response in Human Normal or Cancer Cells [Virus-Cell Interactions]

  • Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-bbeta;) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-bbeta; in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-bbeta; or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors.

    IMPORTANCE Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients. The cancer-selective nature of some oncolytic viruses is based on the impaired innate immunity of many cancer cells. The parvoviruses H-1, LuIII, and MVM target cancer cells; however, their relationship with the innate immune system is relatively uncharacterized. Surprisingly, we found that these parvoviruses do not evoke an interferon response in normal human fibroblasts, glia, or melanocytes. Furthermore, unlike most other types of virus, we found that parvovirus infectivity is unaffected by interferon treatment of human normal or tumor cells. Finally, parvoviral replication was unimpaired by interferon in four human tumor types, including those with residual interferon functionality. We conclude that deficits in the interferon antiviral response of cancer cells do not contribute to parvoviral oncoselectivity in human cells. The interferon-resistant phenotype of parvoviruses may give them an advantage over interferon-sensitive oncolytic viruses in tumors showing residual interferon functionality.

  • Identification and Characterization of a Proteolytically Primed Form of the Murine Coronavirus Spike Proteins after Fusion with the Target Cell [Virus-Cell Interactions]

  • Enveloped viruses carry highly specialized glycoproteins that catalyze membrane fusion under strict spatial and temporal control. To prevent premature activation after biosynthesis, viral class I fusion proteins adopt a locked conformation and require proteolytic cleavage to render them fusion-ready. This priming step may occur during virus exit from the infected cell, in the extracellular milieu or during entry at or in the next target cell. Proteolytic processing of coronavirus spike (S) fusion proteins during virus entry has been suggested but not yet formally demonstrated, while the nature and functionality of the resulting subunit is still unclear. We used a prototype coronavirusmmdash;mouse hepatitis virus (MHV)mmdash;to develop a conditional biotinylation assay that enables the specific identification and biochemical characterization of viral S proteins on virions that mediated membrane fusion with the target cell. We demonstrate that MHV S proteins are indeed cleaved upon virus endocytosis, and we identify a novel processing product S2* with characteristics of a fusion-active subunit. The precise cleavage site and the enzymes involved remain to be elucidated.

    IMPORTANCE Virus entry determines the tropism and is a crucial step in the virus life cycle. We developed an approach to characterize structural components of virus particles after entering new target cells. A prototype coronavirus was used to illustrate how the virus fusion machinery can be controlled.

  • Receptor Variation and Susceptibility to Middle East Respiratory Syndrome Coronavirus Infection [Virus-Cell Interactions]

  • The Middle East respiratory syndrome coronavirus (MERS-CoV) recently spread from an animal reservoir to infect humans, causing sporadic severe and frequently fatal respiratory disease. Appropriate public health and control measures will require discovery of the zoonotic MERS coronavirus reservoirs. The relevant animal hosts are liable to be those that offer optimal MERS virus cell entry. Cell entry begins with virus spike (S) protein binding to DPP4 receptors. We constructed chimeric DPP4 receptors that have the virus-binding domains of indigenous Middle Eastern animals and assessed the activities of these receptors in supporting S protein binding and virus entry. Human, camel, and horse receptors were potent and nearly equally effective MERS virus receptors, while goat and bat receptors were considerably less effective. These patterns reflected S protein affinities for the receptors. However, even the low-affinity receptors could hypersensitize cells to infection when an S-cleaving protease(s) was present, indicating that affinity thresholds for virus entry must be considered in the context of host-cell proteolytic environments. These findings suggest that virus receptors and S protein-cleaving proteases combine in a variety of animals to offer efficient virus entry and that several Middle Eastern animals are potential reservoirs for transmitting MERS-CoV to humans.

    IMPORTANCE MERS is a frequently fatal disease that is caused by a zoonotic CoV. The animals transmitting MERS-CoV to humans are not yet known. Infection by MERS-CoV requires receptors and proteases on host cells. We compared the receptors of humans and Middle Eastern animals and found that human, camel, and horse receptors sensitized cells to MERS-CoV infection more robustly than goat and bat receptors. Infection susceptibility correlated with affinities of the receptors for viral spike proteins. We also found that the presence of a cell surface lung protease greatly increases susceptibility to MERS-CoV, particularly in conjunction with low-affinity receptors. This cataloguing of human and animal host cell factors allows one to make inferences on the distribution of MERS-CoV in nature.

  • Epstein-Barr Virus BALF3 Has Nuclease Activity and Mediates Mature Virion Production during the Lytic Cycle [Genome Replication and Regulation of Viral Gene Expression]

  • Epstein-Barr virus (EBV) lytic replication involves complex processes, including DNA synthesis, DNA cleavage and packaging, and virion egress. These processes require many different lytic gene products, but the mechanisms of their actions remain unclear, especially for DNA cleavage and packaging. According to sequence homology analysis, EBV BALF3, encoded by the third leftward open reading frame of the BamHI-A fragment in the viral genome, is a homologue of herpes simplex virus type 1 UL28. This gene product is believed to possess the properties of a terminase, such as nucleolytic activity on newly synthesized viral DNA and translocation of unit length viral genomes into procapsids. In order to characterize EBV BALF3, the protein was produced by and purified from recombinant baculoviruses and examined in an enzymatic reaction in vitro, which determined that EBV BALF3 acts as an endonuclease and its activity is modulated by Mg2+, Mn2+, and ATP. Moreover, in EBV-positive epithelial cells, BALF3 was expressed and transported from the cytoplasm into the nucleus following induction of the lytic cycle, and gene silencing of BALF3 caused a reduction of DNA packaging and virion release. Interestingly, suppression of BALF3 expression also decreased the efficiency of DNA synthesis. On the basis of these results, we suggest that EBV BALF3 is involved simultaneously in DNA synthesis and packaging and is required for the production of mature virions.

    IMPORTANCE Virus lytic replication is essential to produce infectious virions, which is responsible for virus survival and spread. This work shows that an uncharacterized gene product of the human herpesvirus Epstein-Barr virus (EBV), BALF3, is expressed during the lytic cycle. In addition, BALF3 mediates an endonucleolytic reaction and is involved in viral DNA synthesis and packaging, leading to influence on the production of mature virions. According to sequence homology and physical properties, the lytic gene product BALF3 is considered a terminase in EBV. These findings identify a novel viral gene with an important role in contributing to a better understanding of the EBV life cycle.

  • CD4+ Memory Stem Cells Are Infected by HIV-1 in a Manner Regulated in Part by SAMHD1 Expression [Virus-Cell Interactions]

  • CD4+ and CD8+ memory T cells with stem cell-like properties (TSCM cells) have been identified in mice, humans, and nonhuman primates and are being investigated for antitumor and antiviral vaccines and immunotherapies. Whether CD4+ TSCM cells are infected by human immunodeficiency virus (HIV) was investigated by using a combination HIV reporter virus system in vitro and by direct staining for HIV p24 antigen ex vivo. A proportion of TSCM cells were found to express the HIV coreceptors CCR5 and CXCR4 and were infected by HIV both in vitro and in vivo. Analysis of viral outcome following fusion using the combination reporter virus system revealed that TSCM cells can become productively or latently infected, although the vast majority of TSCM cells are abortively infected. Knockdown of the HIV restriction factor SAMHD1 using Vpx-containing simian immunodeficiency virus (SIV) virion-like particles enhanced the productive infection of TSCM cells, indicating that SAMHD1 contributes to abortive infection in these cells. These results demonstrate that CD4+ TSCM cells are targets for HIV infection, that they become productively or latently infected at low levels, and that SAMHD1 expression promotes abortive infection of this important memory cell subset.

    IMPORTANCE Here we demonstrate the susceptibility of CD4+ memory stem cells (TSCM cells) to infection by HIV in vitro and in vivo, provide an in-depth analysis of coreceptor expression, demonstrate the infection of naiiuml;ve and memory CD4+ T cell subsets with both CCR5- and CXCR4-tropic HIV, and also perform outcome analysis to calculate the percentage of cells that are productively, latently, or abortively infected. Through these outcome studies, we determined that the vast majority of TSCM cells are abortively infected by HIV, and we demonstrate that knockdown of SAMHD1 significantly increases the frequency of infection of this CD4+ T cell subset, indicating that SAMHD1 is an active restriction factor in TSCM cells.

  • Inhibition of Kaposi's Sarcoma-Associated Herpesvirus Lytic Replication by HIV-1 Nef and Cellular MicroRNA hsa-miR-1258 [Genome Replication and Regulation of Viral Gene Expression]

  • Kaposi's sarcoma-associated herpesvirus (KSHV) is causally linked to several AIDS-related malignancies, including Kaposi's sarcoma (KS), primary effusion lymphoma (PEL), and multicentric Castleman's disease. The interaction of human immunodeficiency virus type 1 (HIV-1) and KSHV has a central role in promoting the aggressive manifestations of AIDS-KS. We have previously shown that negative factor (Nef), a secreted HIV-1 protein, synergizes with KSHV viral interleukin-6 (vIL-6) to promote angiogenesis and tumorigenesis by activating the AKT pathway (X. Zhu, et al., Oncogene, 22 April 2013, http://dx.doi.org/10.1038/onc.2013.136). Here, we further demonstrated the role of soluble and ectopic Nef in the regulation of KSHV latency. We found that both soluble Nef protein and ectopic expression of Nef by transfection suppressed the expression of KSHV viral lytic mRNA transcripts and proteins and the production of infectious viral particles. MicroRNA (miRNA) microarray analysis identified a number of Nef-regulated miRNAs. Bioinformatics and luciferase reporter analyses showed that one of the Nef-upregulated miRNAs, cellular miRNA 1258 (hsa-miR-1258), directly targeted a seed sequence in the 3' untranslated region (UTR) of the mRNA encoding the major lytic switch protein (RTA), which controls KSHV reactivation from latency. Ectopic expression of hsa-miR-1258 impaired RTA synthesis and enhanced Nef-mediated inhibition of KSHV replication, whereas repression of hsa-miR-1258 has the opposite effect. Mutation of the seed sequence in the RTA 3'UTR abolished downregulation of RTA by hsa-miR-1258. Collectively, these novel findings demonstrate that, by regulating cellular miRNA, Nef may inhibit KSHV replication to promote viral latency and contribute to the pathogenesis of AIDS-related malignancies.

    IMPORTANCE This study found that Nef, a secreted HIV-1 protein, suppressed KSHV lytic replication to promote KSHV latency. Mechanistic studies indicated that a Nef-upregulated cellular miRNA, hsa-miR-1258, inhibits KSHV replication by directly targeting a seed sequence in the KSHV RTA 3'UTR. These results illustrate that, in addition to viral miRNAs, cellular miRNAs also play an important role in regulating the life cycle of KSHV. Overall, this is the first study to report the involvement of Nef in KSHV latency, implying its likely important role in the pathogenesis of AIDS-related malignancies.

  • Repression of the Proapoptotic Cellular BIK/NBK Gene by Epstein-Barr Virus Antagonizes Transforming Growth Factor {beta}1-Induced B-Cell Apoptosis [Virus-Cell Interactions]

  • The Epstein-Barr virus (EBV) establishes a lifelong latent infection in humans. EBV infection of primary B cells causes cell activation and proliferation, a process driven by the viral latency III gene expression program, which includes EBV nuclear proteins (EBNAs), latent membrane proteins, and untranslated RNAs, including microRNAs. Some latently infected cells enter the long-lived memory B-cell compartment and express only EBNA1 transiently (Lat I) or no EBV protein at all (Lat 0). Targeting the molecular machinery that controls B-cell fate decisions, including the Bcl-2 family of apoptosis-regulating proteins, is crucial to the EBV cycle of infection. Here, we show that BIK (also known as NBK), which encodes a proapoptotic "sensitizer" protein, is repressed by the EBNA2-driven Lat III program but not the Lat I program. BIK repression occurred soon after infection of primary B cells by EBV but not by a recombinant EBV in which the EBNA2 gene had been knocked out. Ectopic BIK induced apoptosis in Lat III cells by a mechanism dependent on its BH3 domain and the activation of caspases. We show that EBNA2 represses BIK in EBV-negative B-cell lymphoma-derived cell lines and that this host-virus interaction can inhibit the proapoptotic effect of transforming growth factor bbeta;1 (TGF-bbeta;1), a key physiological mediator of B-cell homeostasis. Reduced levels of TGF-bbeta;1-associated regulatory SMAD proteins were bound to the BIK promoter in response to EBV Lat III or ectopic EBNA2. These data are evidence of an additional mechanism used by EBV to promote B-cell survival, namely, the transcriptional repression of the BH3-only sensitizer BIK.

    IMPORTANCE Over 90% of adult humans are infected with the Epstein-Barr virus (EBV). EBV establishes a lifelong silent infection, with its DNA residing in small numbers of blood B cells that are a reservoir from which low-level virus reactivation and shedding in saliva intermittently occur. Importantly, EBV DNA is found in some B-cell-derived tumors in which viral genes play a key role in tumor cell emergence and progression. Here, we report for the first time that EBV can shut off a B-cell gene called BIK. When activated by a molecular signal called transforming growth factor bbeta;1 (TGF-bbeta;1), BIK plays an important role in killing unwanted B cells, including those infected by viruses. We describe the key EBVnndash;B-cell molecular interactions that lead to BIK shutoff. These findings further our knowledge of how EBV prevents the death of its host cell during infection. They are also relevant to certain posttransplant lymphomas where unregulated cell growth is caused by EBV genes.

  • Loss of a Conserved N-Linked Glycosylation Site in the Simian Immunodeficiency Virus Envelope Glycoprotein V2 Region Enhances Macrophage Tropism by Increasing CD4-Independent Cell-to-Cell Transmission [Virus-Cell Interactions]

  • Human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) strains differ in their capacity to replicate in macrophages, but mechanisms underlying these differences are not fully understood. Here, we identify a highly conserved N-linked glycosylation site (N173 in SIV, corresponding to N160 in HIV) in the V2 region of the SIV envelope glycoprotein (Env) as a novel determinant of macrophage tropism and characterize mechanisms underlying this phenotype. Loss of the N173 glycosylation site in the non-macrophage-tropic SIVmac239 by introducing an N173Q mutation enhanced viral replication and multinucleated giant cell formation upon infection of rhesus macrophages, while the addition of N173 to SIVmac251 had the opposite effect. The removal of N173 in SIVmac239 enhanced CD4-independent cell-to-cell transmission to CCR5-expressing cells. SIVmac239 with N173Q mediated CD4-independent cell-cell fusion but could not infect CD4-negative cells in single-round infections. Thus, CD4-independent phenotypes were detected only in the context of cell-to-cell contact. Similar results were obtained in SIVmac251 with and without N173. N173 decreased the neutralization sensitivity of SIVmac251 but had no effect on the neutralization sensitivity of SIVmac239. The N173Q mutation had no effect on SIVmac239 binding to CD4 in Biacore assays, coimmunoprecipitation assays, and enzyme-linked immunosorbent assays (ELISAs). These findings suggest that the loss of the N173 N-linked glycosylation site increases SIVmac239 replication in macrophages by enhancing CD4-independent cell-to-cell virus transmission through CCR5-mediated fusion. This mechanism may facilitate the escape of macrophage-tropic viruses from neutralizing antibodies while promoting spreading infection by these viruses in vivo.

    IMPORTANCE In this study, we identify a genetic determinant in the viral envelope (N173) that increases replication and spreading infection of SIV strains in macrophages by enhancing cell-to-cell virus transmission. This effect is explained by a novel mechanism involving increased cell-to-cell fusion in the absence of CD4, the primary receptor that normally mediates virus entry. The same genetic determinant also affects the sensitivity of these viruses to inhibition by neutralizing antibodies. Most macrophage-tropic HIV/SIV strains are known to be neutralization sensitive. Together, these findings suggest that this efficient mode of virus transmission may facilitate the escape of macrophage-tropic viruses from neutralizing antibodies while promoting spreading infection by these viruses to cells expressing little or no CD4 in vivo.

  • Hepatitis A Virus Adaptation to Cellular Shutoff Is Driven by Dynamic Adjustments of Codon Usage and Results in the Selection of Populations with Altered Capsids [Genetic Diversity and Evolution]

  • Hepatitis A virus (HAV) has a highly biased and deoptimized codon usage compared to the host cell and fails to inhibit host protein synthesis. It has been proposed that an optimal combination of abundant and rare codons controls the translation speed required for the correct capsid folding. The artificial shutoff host protein synthesis results in the selection of variants containing mutations in the HAV capsid coding region critical for folding, stability, and function. Here, we show that these capsid mutations resulted in changes in their antigenicity; in a reduced stability to high temperature, low pH, and biliary salts; and in an increased efficacy of cell entry. In conclusion, the adaptation to cellular shutoff resulted in the selection of large-plaque-producing virus populations.

    IMPORTANCE HAV has a naturally deoptimized codon usage with respect to that of its cell host and is unable to shut down the cellular translation. This fact contributes to the low replication rate of the virus, in addition to other factors such as the highly inefficient internal ribosome entry site (IRES), and explains the outstanding physical stability of this pathogen in the environment mediated by a folding-dependent highly cohesive capsid. Adaptation to artificially induced cellular transcription shutoff resulted in a redeoptimization of its capsid codon usage, instead of an optimization. These genomic changes are related to an overall change of capsid folding, which in turn induces changes in the cell entry process. Remarkably, the adaptation to cellular shutoff allowed the virus to significantly increase its RNA uncoating efficiency, resulting in the selection of large-plaque-producing populations. However, these populations produced much-debilitated virions.

  • Delayed Lysis Confers Resistance to the Nucleoside Analogue 5-Fluorouracil and Alleviates Mutation Accumulation in the Single-Stranded DNA Bacteriophage {phi}X174 [Genetic Diversity and Evolution]

  • Rates of spontaneous mutation determine viral fitness and adaptability. In RNA viruses, treatment with mutagenic nucleoside analogues selects for polymerase variants with increased fidelity, showing that viral mutation rates can be adjusted in response to imposed selective pressures. However, this type of resistance is not possible in viruses that do not encode their own polymerases, such as single-stranded DNA viruses. We previously showed that serial passaging of bacteriophage X174 in the presence of the nucleoside analogue 5-fluorouracil (5-FU) favored substitutions in the lysis protein E (P. Domingo-Calap, M. Pereira-Gomez, and R. Sanjuaaacute;n, J. Virol. 86:9640nndash;9646, 2012, doi:10.1128/JVI.00613nndash;12). Here, we found that approximately half (6/12) of the amino acid replacements in the N-terminal region of this protein led to delayed lysis, and two of these changes (V2A and D8A) also conferred partial resistance to 5-FU. By delaying lysis, the V2A and D8A substitutions allowed the virus to increase the burst size per cell in the presence of 5-FU. Furthermore, these substitutions tended to alleviate drug-induced mutagenesis by reducing the number of rounds of copying required for population growth, revealing a new mechanism of resistance. This form of mutation rate regulation may also be utilized by other viruses whose replication mode is similar to that of bacteriophage X174.

    IMPORTANCE Many viruses display high rates of spontaneous mutations due to defects in proofreading or postreplicative repair, allowing them to rapidly adapt to changing environments. Viral mutation rates may have been optimized to achieve high adaptability without incurring an excessive genetic load. Supporting this, RNA viruses subjected to chemical mutagenesis treatments have been shown to evolve higher-fidelity polymerases. However, many viruses cannot modulate replication fidelity because they do not encode their own polymerase. Here, we show a new mechanism for regulating viral mutation rates. We found that, under mutagenic conditions, the single-stranded bacteriophage X174 evolved delayed lysis, and that this allowed the virus to increase the amount of progeny produced per cell. As a result, the viral population was amplified in fewer infection cycles, reducing the chances for mutation appearance.

  • Determining the Involvement and Therapeutic Implications of Host Cellular Factors in Hepatitis C Virus Cell-to-Cell Spread [Virus-Cell Interactions]

  • Hepatitis C virus (HCV) infects 180 million people worldwide and is a leading cause of liver diseases such as fibrosis, cirrhosis, and hepatocellular carcinoma. It has been shown that HCV can spread to naive cells using two distinct entry mechanisms, "cell-free" entry of infectious extracellular virions that have been released by infected cells and direct "cell-to-cell" transmission. Here, we examined host cell requirements for HCV spread and found that the cholesterol uptake receptor NPC1L1, which we recently identified as being an antiviral target involved in HCV cell-free entry/spread, is also required for the cell-to-cell spread. In contrast, the very low density lipoprotein (VLDL) pathway, which is required for the secretion of cell-free infectious virus and thus has been identified as an antiviral target for blocking cell-free virus secretion/spread, is not required for cell-to-cell spread. Noting that HCV cell-free and cell-to-cell spread share some common factors but not others, we tested the therapeutic implications of these observations and demonstrate that inhibitors that target cell factors required for both forms of HCV spread exhibit synergy when used in combination with interferon (a representative inhibitor of intracellular HCV production), while inhibitors that block only cell-free spread do not. This provides insight into the mechanistic basis of synergy between interferon and HCV entry inhibitors and highlights the broader, previously unappreciated impact blocking HCV cell-to-cell spread can have on the efficacy of HCV combination therapies.

    IMPORTANCE HCV can spread to naive cells using distinct mechanisms: "cell-free" entry of extracellular virus and direct "cell-to-cell" transmission. Herein, we identify the host cell HCV entry factor NPC1L1 as also being required for HCV cell-to-cell spread, while showing that the VLDL pathway, which is required for the secretion of cell-free infectious virus, is not required for cell-to-cell spread. While both these host factors are considered viable antiviral targets, we demonstrate that only inhibitors that block factors required for both forms of HCV entry/spread (i.e., NPC1L1) exhibit synergy when used in combination with interferon, while inhibitors that block factors required only for cell-free spread (i.e., VLDL pathway components) do not. Thus, this study advances our understanding of HCV cell-to-cell spread, provides mechanistic insight into the basis of drug synergy, and highlights inhibition of HCV spread as a previously unappreciated consideration in HCV therapy design.

  • Activities of Transmitted/Founder and Chronic Clade B HIV-1 Vpu and a C-Terminal Polymorphism Specifically Affecting Virion Release [Virus-Cell Interactions]

  • Acute HIV-1 infection is characterized by a type I interferon response, resulting in the induction of host restriction factors. HIV-1 has evolved to counteract these factors, and one such adaptation, the ability of Vpu to counteract BST2/tetherin, is associated with the evolution of simian immunodeficiency virus (SIVcpz) into pandemic group M human immunodeficiency virus type 1 (HIV-1). During transmission between individuals, very few viruses or even a single virus, the "transmitted/founder" (T/F) virus, gives rise to the new infection, but in the new host the selective pressure of the immune response yields the diverse "quasispecies" of chronic infection. Here we examine the functional characteristics of Vpu proteins encoded by T/F viruses compared to acute and chronic viruses from longitudinally sampled subjects. The studied T/F Vpu proteins showed a trend toward optimized CD4 downregulation compared to chronic Vpu proteins but did not differ substantially in their ability to downregulate BST2 or enhance virion release, although individual clones from each group were impaired in these activities. Analysis of the functionally impaired clones identified a C-terminal residue, W76, as important specifically for Vpu enhancement of virion release. Primary Vpu clones encoding a W76G polymorphism, or site-directed mutants encoding a W76G substitution, were impaired in their ability to enhance virion release, but they were not defective for BST2 surface downregulation. Conversely, the virion release function of impaired primary clones was restored by creating a G76W substitution. The identification of W76 as important for virion release enhancement that is independent of BST2 surface downregulation supports the potential to mechanistically separate these functions of Vpu.

    IMPORTANCE To establish infection in a host, HIV-1 must evade the host's immune response, including the production of antiviral factors. HIV-1 encodes proteins that antagonize these defenses, including Vpu. Vpu counteracts the host protein BST2, which blocks the release of progeny viruses from the host cell. To determine the importance of Vpu activity to HIV-1 transmission, this study assessed the functionality of Vpu from viruses isolated soon after transmission ("transmitted/founder" viruses) compared to isolates from chronic infection. Although the anti-BST2 activity of Vpu proteins from the tested transmitted/founder viruses did not differ from the activity of the chronic Vpu proteins, the transmitted/founder Vpu proteins trended toward having superior activity against another host protein, CD4. Further, this study identified an amino acid near the C terminus of Vpu that is specifically important for Vpu's ability to enhance the release of progeny virus from the host cell, supporting the notion of a new mechanism for this function of Vpu.

  • Varicella-Zoster Virus and Herpes Simplex Virus 1 Can Infect and Replicate in the Same Neurons whether Co- or Superinfected [Virus-Cell Interactions]

  • The two human neurotropic alphaherpesviruses varicella-zoster virus (VZV) and herpes simplex virus type 1 (HSV1) both establish latency in sensory ganglia. Human trigeminal ganglia are known to frequently harbor both viruses, and there is evidence to suggest the presence of both VZV and HSV1 DNA in the same neuron. We ask here whether VZV and HSV1 can exclude themselves and each other and whether they can productively infect the same cells in human neurons and human foreskin fibroblasts (HFF). Simultaneous infection (coinfection) or consecutive infection (superinfection) was assessed using cell-free HSV1 and VZV expressing fluorescent reporter proteins. Automated analysis was carried out to detect singly and dually infected cells. We demonstrate that VZV and HSV1 both display efficient superinfection exclusion (SE) in HFF, with each virus excluding either itself or the other virus. While SE also occurred in neurons, it was with much lower efficiency. Both alphaherpesviruses productively infected the same neurons, whether applied simultaneously or even consecutively, albeit at lower frequencies.

    IMPORTANCE Superinfection exclusion by VZV for itself or the related neurotropic alphaherpesvirus HSV1 has been studied here for the first time. We find that while these viruses display classic SE in fibroblasts, SE is less efficient for both HSV1 and VZV in human neurons. The ability of multiple VZV strains to productively infect the same neurons has important implications in terms of recombination of both wild-type and vaccine strains in patients.

  • In Vivo Ablation of Type I Interferon Receptor from Cardiomyocytes Delays Coxsackieviral Clearance and Accelerates Myocardial Disease [Pathogenesis and Immunity]

  • Acute coxsackievirus B3 (CVB3) infection is one of the most prevalent causes of acute myocarditis, a disease that frequently is identified only after the sudden death of apparently healthy individuals. CVB3 infects cardiomyocytes, but the infection is highly focal, even in the absence of a strong adaptive immune response, suggesting that virus spread within the heart may be tightly constrained by the innate immune system. Type I interferons (T1IFNs) are an obvious candidate, and T1IFN receptor (T1IFNR) knockout mice are highly susceptible to CVB3 infection, succumbing within a few days of challenge. Here, we investigated the role of T1IFNs in the heart using a mouse model in which the T1IFNR gene can be ablated in vivo, specifically in cardiomyocytes. We found that T1IFN signaling into cardiomyocytes contributed substantially to the suppression of viral replication and infectious virus yield in the heart; in the absence of such signaling, virus titers were markedly elevated by day 3 postinfection (p.i.) and remained high at day 12 p.i., a time point at which virus was absent from genetically intact littermates, suggesting that the T1IFN-unresponsive cardiomyocytes may act as a safe haven for the virus. Nevertheless, in these mice the myocardial infection remained highly focal, despite the cardiomyocytes' inability to respond to T1IFN, indicating that other factors, as yet unidentified, are sufficient to prevent the more widespread dissemination of the infection throughout the heart. The absence of T1IFN signaling into cardiomyocytes also was accompanied by a profound acceleration and exacerbation of myocarditis and by a significant increase in mortality.

    IMPORTANCE Acute coxsackievirus B3 (CVB3) infection is one of the most common causes of acute myocarditis, a serious and sometimes fatal disease. To optimize treatment, it is vital that we identify the immune factors that limit virus spread in the heart and other organs. Type I interferons play a key role in controlling many virus infections, but it has been suggested that they may not directly impact CVB3 infection within the heart. Here, using a novel line of transgenic mice, we show that these cytokines signal directly into cardiomyocytes, limiting viral replication, myocarditis, and death.

  • Development of an Adenovirus-Based Respiratory Syncytial Virus Vaccine: Preclinical Evaluation of Efficacy, Immunogenicity, and Enhanced Disease in a Cotton Rat Model [Vaccines and Antiviral Agents]

  • The lack of a vaccine against respiratory syncytial virus (RSV) is a challenging and serious gap in preventive medicine. Herein, we characterize the immunogenicity of an adenovirus serotype 5-based RSV vaccine encoding the fusion (F) protein (Ad5.RSV-F) and the protection provided following immunization with Ad5.RSV-F and assess its potential for producing enhanced disease in a cotton rat (CR) model. Animals were immunized intranasally (i.n.) and/or intramuscularly (i.m.) and subsequently challenged with RSV/A/Tracy (i.n.) to assess protection. Robust immune responses were seen in CRs vaccinated with Ad5.RSV-F given i.m. or i.n., and these responses correlated with reduced replication of the virus in noses and lungs after challenge. Neutralizing antibody responses following immunization with a single dose of Ad5.RSV-F at 1 x 1011 viral particles (v.p.) elicited antibody titers 64- to 256-fold greater than those seen after natural infection. CRs boosted with Ad5.RSV-F i.n. 28 days after an i.m. dose also had significant increases in neutralizing antibody titers. Antibody affinity for different F-protein antigenic sites revealed substantial differences between antibodies elicited by Ad5.RSV-F and those seen after RSV infection; differences in antibody profiles were also seen between CRs given Ad5.RSV-F i.m. and CRs given Ad5.RSV-F i.n. Ad5.RSV-F priming did not result in enhanced disease following live-virus challenge, in contrast to the histopathology seen in CRs given the formalin-inactivated RSV/A/Burnett vaccine.

    IMPORTANCE Respiratory syncytial virus (RSV) is the most common cause of acute lower respiratory infection in infants and young children and a serious health threat in the immunocompromised and the elderly. Infection severity increased in children in an immunization trial, hampering the over 4-decade-long quest for a successful RSV vaccine. In this study, we show that a genetically engineered RSV-F-encoding adenoviral vector provides protective immunity against RSV challenge without enhanced lung disease in cotton rats (CRs). CRs were vaccinated under a number of different regimens, and the immunity induced by the recombinant adenoviral RSV vaccine administered by use of an intramuscular prime-intranasal boost regimen may provide the best protection for young infants and children at risk of RSV infection, since this population is naive to adenoviral preformed immunity. Overall, this report describes a potential RSV vaccine candidate that merits further evaluation in a phase I clinical study in humans.

  • Dendritic Cell-Lymphocyte Cross Talk Downregulates Host Restriction Factor SAMHD1 and Stimulates HIV-1 Replication in Dendritic Cells [Virus-Cell Interactions]

  • Human immunodeficiency virus type 1 (HIV-1) replication in dendritic cells (DCs) is restricted by SAMHD1. This factor is counteracted by the viral protein Vpx; Vpx is found in HIV-2 and simian immunodeficiency virus (SIV) from sooty mangabeys (SIVsm) or from macaques (SIVmac) but is absent from HIV-1. We previously observed that HIV-1 replication in immature DCs is stimulated by cocultivation with primary T and B lymphocytes, suggesting that HIV-1 restriction in DCs may be overcome under coculture conditions. Here, we aimed to decipher the mechanism of SAMHD1-mediated restriction in DC-lymphocyte coculture. We found that coculture with lymphocytes downregulated SAMHD1 expression and was associated with increased HIV-1 replication in DCs. Moreover, in infected DC-T lymphocyte cocultures, DCs acquired maturation status and secreted type 1 interferon (alpha interferon [IFN-aalpha;]). The blockade of DC-lymphocyte cross talk by anti-ICAM-1 antibody markedly inhibited the stimulation of HIV-1 replication and prevented the downregulation of SAMHD1 expression in cocultured DCs. These results demonstrate that, in contrast to purified DCs, cross talk with lymphocytes downregulates SAMHD1 expression in DCs, triggering HIV-1 replication and an antiviral immune response. Therefore, HIV-1 replication and immune sensing by DCs should be investigated in more physiologically relevant models of DC/lymphocyte coculture.

    IMPORTANCE SAMHD1 restricts HIV-1 replication in dendritic cells (DCs). Here, we demonstrate that, in a coculture model of DCs and lymphocytes mimicking early mucosal HIV-1 infection, stimulation of HIV-1 replication in DCs is associated with downregulation of SAMHD1 expression and activation of innate immune sensing by DCs. We propose that DC-lymphocyte cross talk occurring in vivo modulates host restriction factor SAMHD1, promoting HIV-1 replication in cellular reservoirs and stimulating immune sensing.

  • Heat Shock Protein 70 Enhances Mucosal Immunity against Human Norovirus When Coexpressed from a Vesicular Stomatitis Virus Vector [Vaccines and Antiviral Agents]

  • Human norovirus (NoV) accounts for 95% of nonbacterial gastroenteritis worldwide. Currently, there is no vaccine available to combat human NoV as it is not cultivable and lacks a small-animal model. Recently, we demonstrated that recombinant vesicular stomatitis virus (rVSV) expressing human NoV capsid protein (rVSV-VP1) induced strong immunities in mice (Y. Ma and J. Li, J. Virol. 85:2942nndash;2952, 2011). To further improve the safety and efficacy of the vaccine candidate, heat shock protein 70 (HSP70) was inserted into the rVSV-VP1 backbone vector. A second construct was generated in which the firefly luciferase (Luc) gene was inserted in place of HSP70 as a control for the double insertion. The resultant recombinant viruses (rVSV-HSP70-VP1 and rVSV-Luc-VP1) were significantly more attenuated in cell culture and viral spread in mice than rVSV-VP1. At the inoculation dose of 1.0 x 106 PFU, rVSV-HSP70-VP1 triggered significantly higher vaginal IgA than rVSV-VP1 and significantly higher fecal and vaginal IgA responses than rVSV-Luc-VP1, although serum IgG and T cell responses were similar. At the inoculation dose of 5.0 x 106 PFU, rVSV-HSP70-VP1 stimulated significantly higher T cell, fecal, and vaginal IgA responses than rVSV-VP1. Fecal and vaginal IgA responses were also significantly increased when combined vaccination of rVSV-VP1 and rVSV-HSP70 was used. Collectively, these data indicate that (i) insertion of an additional gene (HSP70 or Luc) into the rVSV-VP1 backbone further attenuates the VSV-based vaccine in vitro and in vivo, thus improving the safety of the vaccine candidate, and (ii) HSP70 enhances the human NoV-specific mucosal and T cell immunities triggered by a VSV-based human NoV vaccine.

    IMPORTANCE Human norovirus (NoV) is responsible for more than 95% of acute nonbacterial gastroenteritis worldwide. Currently, there is no vaccine for this virus. Development of a live attenuated vaccine for human NoV has not been possible because it is uncultivable. Thus, a live vector-based vaccine may provide an alternative vaccine strategy. In this study, we developed a vesicular stomatitis virus (VSV)-based human NoV vaccine candidate. We constructed rVSV-HSP70-VP1, coexpressing heat shock protein (HSP70) and capsid (VP1) genes of human NoV, and rVSV-Luc-VP1, coexpressing firefly luciferase (Luc) and VP1 genes. We found that VSVs with a double gene insertion were significantly more attenuated than VSV with a single VP1 insertion (rVSV-VP1). Furthermore, we found that coexpression or coadministration of HSP70 from VSV vector significantly enhanced human NoV-specific mucosal immunity. Collectively, we developed an improved live vectored vaccine candidate for human NoV which will be useful for future clinical studies.

  • Coxsackievirus A9 Infects Cells via Nonacidic Multivesicular Bodies [Virus-Cell Interactions]

  • Coxsackievirus A9 (CVA9) is a member of the human enterovirus B species in the Enterovirus genus of the family Picornaviridae. According to earlier studies, CVA9 binds to aalpha;Vbbeta;3 and aalpha;Vbbeta;6 integrins on the cell surface and utilizes bbeta;2-microglobulin, dynamin, and Arf6 for internalization. However, the structures utilized by the virus for internalization and uncoating are less well understood. We show here, based on electron microscopy, that CVA9 is found in multivesicular structures 2 h postinfection (p.i.). A neutral red labeling assay revealed that uncoating occurs mainly around 2 h p.i., while double-stranded RNA is found in the cytoplasm after 3 h p.i. The biogenesis of multivesicular bodies (MVBs) is crucial for promoting infection, as judged by the strong inhibitory effect of the wild-type form of Hrs and dominant negative form of VPS4 in CVA9 infection. CVA9 infection is dependent on phospholipase C at the start of infection, whereas Rac1 is especially important between 1 and 3 h p.i., when the virus is in endosomes. Several lines of evidence implicate that low pH does not play a role in CVA9 infection. The infection is not affected by Bafilomycin A1. In addition, CVA9 is not targeted to acidic late endosomes or lysosomes, and the MVBs accumulating CVA9 have a neutral pH. Thus, CVA9 is the second enterovirus demonstrated so far, after echovirus 1, that can trigger neutral MVBs, which are important for virus infection.

    IMPORTANCE We demonstrate here that the enterovirus coxsackievirus A9 (CVA9) uses a nonclathrin and nonacidic pathway to infect cells. CVA9 does not accumulate in conventional late endosomes or lysosomes. We found that inhibitors of phospholipase C (PLC), Rac1, and the Na+/H+ exchanger decreased CVA9 infection. The PLC inhibitor acts on early entry, the Rac1 inhibitor acts between 1 and 3 h, when the virus is in endosomes, and the Na+/H+ exchange inhibitor acts during various steps during the virus life cycle. The infection depends on the formation of novel neutral multivesicular bodies (MVBs), which accumulate CVA9 during the first hours of entry. Thus, CVA9 is the second enterovirus demonstrated so far, after echovirus 1, that can trigger formation of neutral MVBs. The data show that these enteroviruses favor nonacidic conditions and complex MVBs to promote virus infection.

  • Mitophagy Enhances Oncolytic Measles Virus Replication by Mitigating DDX58/RIG-I-Like Receptor Signaling [Virus-Cell Interactions]

  • The success of future clinical trials with oncolytic viruses depends on the identification and the control of mechanisms that modulate their therapeutic efficacy. In particular, little is known about the role of autophagy in infection by attenuated measles virus of the Edmonston strain (MV-Edm). We investigated the interaction between autophagy, innate immune response, and oncolytic activity of MV-Edm, since the antiviral immune response is a known factor limiting virotherapies. We report that MV-Edm exploits selective autophagy to mitigate the innate immune response mediated by DDX58/RIG-I like receptors (RLRs) in non-small cell lung cancer (NSCLC) cells. Both RNA interference (RNAi) and overexpression approaches demonstrate that autophagy enhances viral replication and inhibits the production of type I interferons regulated by RLRs. We show that MV-Edm unexpectedly triggers SQSTM1/p62-mediated mitophagy, resulting in decreased mitochondrion-tethered mitochondrial antiviral signaling protein (MAVS) and subsequently weakening the innate immune response. These results unveil a novel infectious strategy based on the usurpation of mitophagy leading to mitigation of the innate immune response. This finding provides a rationale to modulate autophagy in oncolytic virotherapy.

    IMPORTANCE In vitro studies, preclinical experiments in vivo, and clinical trials with humans all indicate that oncolytic viruses hold promise for cancer therapy. Measles virus of the Edmonston strain (MV-Edm), which is an attenuated virus derived from the common wild-type measles virus, is paradigmatic for therapeutic oncolytic viruses. MV-Edm replicates preferentially in and kills cancer cells. The efficiency of MV-Edm is limited by the immune response of the host against viruses. In our study, we revealed that MV-Edm usurps a homeostatic mechanism of intracellular degradation of mitochondria, coined mitophagy, to attenuate the innate immune response in cancer cells. This strategy might provide a replicative advantage for the virus against the development of antiviral immune responses by the host. These findings are important since they may not only indicate that inducers of autophagy could enhance the efficacy of oncolytic therapies but also provide clues for antiviral therapy by targeting SQSTM1/p62-mediated mitophagy.

  • Capacity for Infectious HIV-1 Virion Capture Differs by Envelope Antibody Specificity [Pathogenesis and Immunity]

  • Antibody capacity to recognize infectious virus is a prerequisite of many antiviral functions. We determined the infectious virion capture index (IVCI) of different antibody specificities. Whereas broadly neutralizing antibodies (bNAbs), except for an MPER bNAb, selectively captured infectious virions, non-bNAbs and mucosal human immunodeficiency virus type 1 (HIV-1)-positive IgG captured subsets of both infectious and noninfectious virions. Infectious virion capture was additive with a mixture of antibodies, providing proof of concept for vaccine-induced antibodies that together have improved capacity to recognize infectious virions.

  • Functional Rectification of the Newly Described African Henipavirus Fusion Glycoprotein (Gh-M74a) [Virus-Cell Interactions]

  • Recent evidence identified multiple Henipavirus species in Africa distinct from those in Southeast Asia and Australia. The reported fusion glycoprotein (F) sequence of the African Gh-M74a strain (GhV-F) is likely incorrect: a single base pair deletion near the N terminus results in multiple aberrancies. Rectifying this by adding single nucleotide insertions results in a GhV-F that now possesses a signal peptide, is efficiently cell surface expressed, exhibits syncytium formation when coexpressed with GhV-G protein, and mediates pseudotyped viral particle entry.

  • Lymphocyte Gene Expression and JC Virus Noncoding Control Region Sequences Are Linked with the Risk of Progressive Multifocal Leukoencephalopathy [Genome Replication and Regulation of Viral Gene Expression]

  • Progressive multifocal leukoencephalopathy (PML)-derived noncoding control region (NCCR) sequences permitted greater early viral gene expression than kidney-associated NCCR sequences. This was driven in part by binding of the transcription factor Spi-B to unique PML-associated Spi-B binding sites. Spi-B is upregulated in developing B cells in response to natalizumab therapy, a known risk factor for PML. Naturally occurring JCV sequence variation, together with drug treatment-induced cellular changes, may synergize to create an environment leading to an increased risk of PML.

  • Limited Hepatitis B Virus Replication Space in the Chronically Hepatitis C Virus-Infected Liver [Pathogenesis and Immunity]

  • We compared the kinetics and magnitude of hepatitis B virus (HBV) infection in hepatitis C virus (HCV)-naive and chronically HCV-infected chimpanzees in whose livers type I interferon-stimulated gene (ISG) expression is strongly induced. HBV infection was delayed and attenuated in the HCV-infected animals, and the number of HBV-infected hepatocytes was drastically reduced. These results suggest that establishment of HBV infection and its replication space is limited by the antiviral effects of type I interferon in the chronically HCV-infected liver.

  • Role of the Immunoreceptor Tyrosine-Based Activation Motif of Latent Membrane Protein 2A (LMP2A) in Epstein-Barr Virus LMP2A-Induced Cell Transformation [Transformation and Oncogenesis]

  • Latent membrane protein 2A (LMP2A) of Epstein-Barr virus (EBV) is widely expressed in EBV-associated malignancies. We demonstrate that LMP2A has a transformation ability. This study shows that LMP2A-induced transformation in several human nonhematopoietic cell lines was blocked in those cells expressing an immunoreceptor tyrosine-based activation motif (ITAM) LMP2A mutant. The Syk inhibitor or Syk-specific small interfering RNA (siRNA) inhibited LMP2A-induced transformation. These results indicate that the interaction of the LMP2A ITAM with Syk is a key step for LMP2A-mediated transformation.

  • Mouse Dipeptidyl Peptidase 4 Is Not a Functional Receptor for Middle East Respiratory Syndrome Coronavirus Infection [Virus-Cell Interactions]

  • Human dipeptidyl peptidase 4 (hDPP4) was recently identified as the receptor for Middle East respiratory syndrome coronavirus (MERS-CoV) infection, suggesting that other mammalian DPP4 orthologs may also support infection. We demonstrate that mouse DPP4 cannot support MERS-CoV infection. However, employing mouse DPP4 as a scaffold, we identified two critical amino acids (A288L and T330R) that regulate species specificity in the mouse. This knowledge can support the rational design of a mouse-adapted MERS-CoV for rapid assessment of therapeutics.

  • CD8+ T Cells Are Essential for Controlling Acute Friend Retrovirus Infection in C57BL/6 Mice [Letters to the Editor]

  • Reply to "CD8+ T Cells Are Essential for Controlling Acute Friend Virus Infection in C57BL/6 Mice" [Letters to the Editor]

  • Dissection of Functional Sites in Herpesvirus Saimiri Complement Control Protein Homolog [Errata]

  • Differential In Vitro Immortalization Capacity of Eleven (Probable) High-Risk Human Papillomavirus Types [Errata]

  • The Kaposi's Sarcoma-Associated Herpesvirus (KSHV)-Induced 5-Lipoxygenase-Leukotriene B4 Cascade Plays Key Roles in KSHV Latency, Monocyte Recruitment, and Lipogenesis [Author Correction]

  • Return To Top of the Page

    Advanced Publication Articles

    Return To Top of the Page

    JVI Accepts: Articles Published Ahead of Print

  • Type I IFN signals in macrophages and dendritic cells control dengue virus infection: implications for a new mouse model to test dengue vaccines [PublishAheadOfPrint]

  • Dengue virus (DENV) infects an estimated 400 million people every year causing prolonged morbidity and sometimes mortality. Development of an effective vaccine has been hampered by the lack of appropriate small animal models; mice are naturally not susceptible to DENV and only become infected if highly immuno-compromised. Mouse models lacking both type I and type II IFN receptors (AG129 mice), or the type I IFN receptor (IFNARnndash;/nndash; mice) are susceptible to infection with mouse adapted DENV strains but are severely impaired in mounting functional immune responses to the virus and thus are of limited use for study. Here we used conditional deletion of the type I IFN receptor (IFNAR) on individual immune cell subtypes to generate a minimally manipulated mouse model that is susceptible to DENV whilst retaining global immune competence. Mice lacking IFNAR expression on CD11c+ dendritic cells and LysM+ macrophages succumbed completely to DENV infection, while mice deficient in the receptor on either CD11c+ or LysM+ cells were susceptible to infection but often resolved viremia and recovered fully from infection. Conditional IFNAR mice responded with a swift and strong CD8+ T-cell response to viral infection, compared to a weak response in IFNARnndash;/nndash; mice. Furthermore, mice lacking IFNAR on either CD11c+ or LysM+ cells were also sufficiently immune competent to raise a protective immune response to a candidate subunit vaccine against DENV-2. These data demonstrate that mice with conditional deficiencies in expression of the IFNAR represent improved models for the study of DENV immunology and screening of vaccine candidates.

    Importance Dengue virus infects 400 million people every year worldwide causing 100 million clinically apparent infections, which can be fatal if untreated. Despite many years of research there is no effective vaccine and no antiviral treatment available for dengue. Development of vaccines has been hampered in particular by the lack of a suitable small animal model. Mouse models used to test dengue vaccine are deficient in interferon (IFN) type I signaling and severely immuno-compromised and therefore likely not ideal for the testing of vaccines. In this study we explored alternative models lacking the IFN receptor only on certain cell types. We show that mice lacking the IFN receptor on either CD11c- or LysM-expressing cells (conditional IFNAR mice) are susceptible to dengue infection. Importantly, we demonstrate that conditional IFN receptor knockout mice generate a better immune response to live virus and a candidate dengue vaccine compared to IFNAR mice and are resistant to subsequent challenge.

  • The mechanism and significance of cell type-dependent neutralization of flaviviruses [PublishAheadOfPrint]

  • The production of neutralizing antibodies (nAbs) is a correlate of protection for many human vaccines, including currently licensed vaccines against flaviviruses. nAbs are typically measured using a plaque reduction neutralization test (PRNT). Despite its extensive use, parameters that impact the performance of the PRNT have not been investigated from a mechanistic perspective. The results of a recent phase IIb clinical trial of a tetravalent dengue virus (DENV) vaccine suggests that nAbs, as measured using a PRNT performed with Vero cells, do not correlate with protection. This surprising finding highlights the importance of understanding how well the PRNT captures the complexity of the nAb response to DENV. In this study, we demonstrate that the structural heterogeneity of flaviviruses arising from inefficient virion maturation impacts the results of neutralization assays in a cell type-dependent manner. Neutralization titers of several monoclonal antibodies were significantly reduced when assayed on Vero cells, as compared to Raji cells expressing DC-SIGNR. This pattern can be explained by differences in the efficiency with which partially mature flaviviruses attach to each cell type, rather than a differential capacity of antibody to block infection. Vero cells are poorly permissive to the fraction of virions that are most sensitive to neutralization. Analysis of sera from recipients of live-attenuated monovalent DENV vaccine candidates revealed a strong correlation between the sensitivity of serum antibodies to the maturation state of DENV and cell type-dependent patterns of neutralization. Cross-reactive patterns of neutralization may be under-represented by the "gold-standard" PRNT that employs Vero cells.

    Importance Cell type-dependent patterns of neutralization describes a differential capacity of antibodies to inhibit virus infection when assayed on multiple cellular substrates. In this study, we establish a link between antibodies that neutralize infection in a cell type-dependent fashion and those sensitive to the maturation state of the flavivirus virion. We demonstrate that cell type-dependent neutralization reflects a differential capacity to measure neutralization of viruses that are incompletely mature. Partially mature virions that most efficiently bind maturation state-sensitive antibodies are poorly represented by assays typically used in support of flavivirus vaccine development. The selection of cellular substrate for neutralization assays may significantly impact evaluation of the neutralization potency of the polyclonal response. These data suggest that current assays do not adequately capture the full complexity of the neutralizing antibody response and may hinder the identification of correlates of protection following flavivirus vaccination.

  • Determinants of Moloney murine leukemia virus Gag-Pol and genomic RNA proportions [PublishAheadOfPrint]

  • The Moloney murine leukemia virus (MoMLV) ribonucleoprotein complex is composed of an approximately 20:1 mixture of Gag and Gag-Pol polyproteins plus a single genomic RNA (gRNA) dimer. The mechanisms that regulate these proportions are unknown. Here, we examined whether virion proportions of Gag, Gag-Pol, and gRNA were determined by sampling (that is, if they reflected expression ratios or intracellular concentrations) or more specific recruitment. To this end, MoMLV Gag, Gag-Pol, and gRNA were expressed separately or together in various ratios. Varying expression ratios of Gag and Gag-Pol revealed that Gag-Pol incorporation was stochastic, and that the conserved 20:1 Gag:Gag-Pol ratio coincided with maximal particle production. When skewed expression ratios resulted in excess Gag-Pol, released virions maintained intracellular Gag:Gag-Pol ratios and infectivity per virion was largely maintained, but virion production decreased sharply with high levels of Gag-Pol. The determinants of gRNA proportions were addressed by manipulating amounts and contexts of functional nucleocapsid (NC), and ratios of Gag to gRNA. The results showed that the NC domain of either Gag or Gag-Pol could provide gRNA packaging functions equally well. Unlike Gag-Pol, gRNA incorporation was saturable. An upper limit of gRNA incorporation was observed, and particle production was not disrupted by excess gRNA expression. These results indicate that the determinants of Gag:Gag-Pol proportions differ from those for Gag:gRNA. Based on the assumption that MoMLV evolved to produce virion components in optimal proportions, these data provide a means of estimating the proportion of unspliced MoMLV RNA that serves as genomic RNA.

    IMPORTANCE Viruses assemble their progeny from within the cells they parasitize, where they must sort through a rich milieu of host proteins and nucleic acids to gather together their own building blocks, which are also proteins and nucleic acids. The research described here addresses whether or not the proportions of viral proteins and nucleic acids that are brought together to form a retroviral particle are determined by random sampling from the cellnndash; and thus dictated by the componentsrrsquo; availabilities within the cellnndash;or if the amounts of each molecule is specified by the virus replication process. The results indicated that protein components of the murine retrovirus studied here are recruited by chance, but that a specific counting mechanism defines the amount of nucleic acid incorporated into each progeny virion.

  • The Role of Herpes Simplex Virus 1 Immediate-Early Protein ICP22 in Viral Nuclear Egress [PublishAheadOfPrint]

  • In order to investigate the novel function(s) of the herpes simplex virus 1 (HSV-1) immediate-early protein, ICP22, we screened for ICP22-binding proteins in HSV-1-infected cells. Our results were as follows. (i) Tandem affinity purification of ICP22 from infected cells, coupled with mass spectrometry-based proteomics and subsesquent analyses demonstrates that ICP22 forms a complex(es) with the HSV-1 proteins UL31, UL34, UL47 (or VP13/14) and/or Us3. All these proteins have previously been reported to be important for viral egress through the nuclear membrane. (ii) ICP22 co-localizes with UL31 and UL34 at the nuclear membrane in wild-type HSV-1-infected cells. (iii) The UL31-null mutation prevents the targeting of ICP22 to the nuclear membrane. (iv) The ICP22-null mutation resulted in UL31 and UL34 mis-localized in the endoplasmic reticulum (in addition to the nuclear membrane) and significantly reduced numbers of primary enveloped virions in the perinuclear space, although capsids accumulated in the nuclei. Collectively, these results suggest that (i) ICP22 interacts with HSV-1 regulators of nuclear egress including UL31, UL34, UL47 and Us3 in HSV-1-infected cells, (ii) UL31 mediates the recruitment and anchorage of ICP22 at the nuclear membrane, and (iii) ICP22 plays a regulatory role in HSV-1 primary envelopment probably by interacting with and regulating UL31 and UL34. Here we report a previously unknown function for ICP22 in the regulation of HSV-1 nuclear egress.

    IMPORTANCE Herpes simplex virus 1 (HSV-1) immediate-early protein ICP22 is primarily recognized as a regulator of viral gene expression. In this study, we show that ICP22 interacts with the HSV-1 proteins UL31 and UL34, that play crucial roles at the nuclear membrane in HSV-1 primary envelopment during viral nuclear egress. We also demonstrate that UL31 is required for the targetting of ICP22 to the nuclear membrane and that ICP22 is required for correct localization of UL31 and/or UL34. Further, we confirm that ICP22 is required for efficient HSV-1 primary envelopment during viral nuclear egress. Thus we report, for the first time, that ICP22 plays a regulatory role in HSV-1 nuclear egress.

  • Phosphorylation of highly conserved serine residues in the influenza A virus nuclear export protein NEP plays a minor role in viral growth in human cells and mice. [PublishAheadOfPrint]

  • Phosphorylation at the highly conserved serine residues S23 to S25 in NEP of influenza A viruses was suspected to regulate its nuclear export activity or polymerase-activity enhancing function. Mutation of these phosphoacceptor sites to either alanine or aspartic acid showed only a minor effect on both activities, but revealed the presence of other phosphoacceptor sites that might be involved in regulating NEP activity.

  • CTCF Binding to the First Intron of the Major Immediate-Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication [PublishAheadOfPrint]

  • Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate early (IE), early (E) and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by shRNA results in an increase in the major IE (MIE) and early gene expression and about 50-fold increase of HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of MIE gene that directly interacts with CTCF. Deletion of this CTCF binding site led to an increase in MIE gene expression in both transient transfection and infection assays. Deletion of the CTCF binding site in the HCMV BACmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF.

    IMPORTANCE Our findings that CTCF binds to intron A of cytmegalovirs (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. First, it is, for the first time that a chromatin-organizing factor CTCF has been discovered to facilitate human CMV (HCMV) gene expression that leads to affecting viral replication. Second, the we identified a CTCF-binding motif in the first intron (also called intron A)that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.

  • Characterization of The Nucleocytoplasmic Shuttle of The Matrix Protein of Influenza B Virus [PublishAheadOfPrint]

  • Influenza B virus is an enveloped negative-strand RNA virus, that contributes considerably to annual influenza illnesses in human. The matrix protein of influenza B virus (BM1) acts as a cytoplasmic-nuclear shuttling protein during the early and late stages of infection. The mechanism of this intracellular transport of BM1 was revealed through the identification of two leucine-rich CRM1-dependent nuclear export signals (NESs) (3-14aa and 124-133aa), one bipartite nuclear localization signal (NLS) (76-94aa), and two phosphorylation sites (80T and 84S) in BM1. The biological function of the NLS and NES regions were determined through the observation of the intracellular distribution of EGFP-tagged signal peptides, and WT, NES-mutant and NLS-mutant EGFP-BM1. Furthermore, the NLS phosphorylation sites 80T and 84S, were found to be required for the nuclear accumulation of EGFP-NLS and for the efficient binding of EGFP-BM1 to human importin-aalpha; 1. Moreover, all of these regions/sites were required for the generation of viable influenza B virus in a 12-plasmid virus rescue system.

    Importance This study expands our understanding of the life cycle of influenza B virus by defining defines/presents the dynamic mechanism of the nucleocytoplasmic shuttle of BM1, and could provide a scientific basis for the development of anti-viral medication.

  • Chimeric GII.4 Norovirus Virus-like Particle Based Vaccines Induce Broadly Blocking Immune Responses [PublishAheadOfPrint]

  • There is currently no licensed vaccine for noroviruses, and development is hindered, in part, by an incomplete understanding of the host adaptive immune response to these highly heterogeneous viruses and rapid GII.4 norovirus molecular evolution. Emergence of a new predominant GII.4 norovirus strain occurs every 2-4 years. To address the problem of GII.4 antigenic variation, we tested the hypothesis that chimeric virus-like particle (VLP)-based vaccine platforms, which incorporate antigenic determinants from multiple strains into a single genetic background, will elicit a broader immune response against contemporary and emergent strains. Here, we compare the immune response generated by chimeric VLPs to that of parental strains and a multivalent VLP cocktail. Results demonstrate that chimeric VLPs induce a more broadly cross-blocking immune response than single parental VLPs and a similar response to a multivalent GII.4 VLP cocktail. Furthermore, we show that incorporating epitope site A alone from one strain into the background of another is sufficient to induce a blockade response against the strain donating epitope site A. This suggests a mechanism by which population-wide surveillance of mutations in a single epitope could be used evaluate antigenic changes in order to identify potential emergent strains and quickly reformulate vaccines against future epidemic strains as they emerge in human populations.

    Importance Noroviruses are gastrointestinal pathogens that infect an estimated 21 million people per year in the United States alone. GII.4 noroviruses account for ggt;70% of all outbreaks, making them the most clinically-important genotype. GII.4 noroviruses undergo a pattern of epochal evolution, resulting in the emergence of new strains with altered antigenicity over time, complicating vaccine design. This work is relevant to norovirus vaccine design as it demonstrates the potential for development of a chimeric VLP-based vaccine platform that may broaden the protective response against multiple GII.4 strains and proposes a potential reformulation strategy to control newly emergent strains in the human population.

  • Vaginal Myeloid Dendritic Cells Transmit Founder HIV-1 [PublishAheadOfPrint]

  • We report that primary human vaginal dendritic cells (DCs) display a myeloid phenotype and express CD4, CCR5 and CXCR4. Vaginal CD13+CD11c+ DCs rapidly and efficiently bound transmitted/founder (T/F) CCR5-tropic (R5) viruses, transported them through explanted vaginal mucosa, and transmitted them in trans to vaginal and blood lymphocytes. Vaginal myeloid DCs may play a key role in capturing and disseminating T/F R5 HIV-1 in vivo and are candidate "gatekeeper" cells in HIV-1 transmission.

  • Induction of Gag-specific CD4 T cell responses during acute HIV infection is associated with improved viral control [PublishAheadOfPrint]

  • Effector CD4 T cell responses have been shown to be critically involved in the containment and clearance of viral pathogens. However, their involvement in the pathogenesis of HIV infection is less clear given their additional role as preferred viral targets. We previously demonstrated that the presence of HIV-specific CD4 T cell responses is rather associated with HIV control and that specific CD4 T cell function such as direct cytolytic activity can contribute to control of HIV viremia. However, little is known about how the induction of HIV-specific CD4 T cell responses during acute HIV infection influences disease progression and whether responses induced during the early phase of infection are preferentially depleted. We therefore longitudinally assessed in a cohort of fifty-five acutely HIV infected individuals HIV-specific CD4 T cell responses from acute to chronic infection. Interestingly, we found that the breadth, magnitude and protein dominance of HIV-specific CD4 T cell responses remained remarkably stable over time. Moreover, we found that the epitopes targeted in a high frequency in acute HIV infection were recognized at a same frequency by HIV-specific CD4 T cells in chronic HIV infection. Interestingly the induction of Gag-specific CD4 T cell responses in acute HIV infection was significantly inversely correlated with a lower viral set point in chronic HIV infection (R=nndash;0.5, p=0.03), while the cumulative contribution of Env-specific CD4 T cell responses showed the reverse effect. Moreover, individuals with HIV-specific CD4 T cell responses dominantly targeting Gag over Env in acute HIV infection remained off antiretroviral therapy significantly longer (p=0.03, log-rank). Thus, our data suggest that the induction of HIV-specific CD4 T cell responses during acute HIV infection is beneficial for and does not fuel disease progression.

    Importance CD4 T cells are critical for the clearance and control of viral infections. However, HIV preferentially infects HIV-specific CD4 T cells. Thus, their contribution to the control of HIV viremia is uncertain. Here, we study HIV-specific CD4 T cell responses from acute to chronic HIV infection and show that the generation of certain CD4 responses is associated with control rather than disease progression.

  • Intra-host dynamics of influenza virus reassortment [PublishAheadOfPrint]

  • The segmented nature of the influenza virus genome allows reassortment between co-infecting viruses. This process of genetic exchange vastly increases the diversity of circulating influenza viruses. The importance of reassortment to public health is clear from its role in the emergence of a number of epidemiologically important viruses, including novel pandemic and epidemic strains. To gauge its impact on within-host genomic variation, we tracked reassortment in co-infected guinea pigs over time and given matched or discordant doses of co-infecting viruses. To ensure unbiased detection of reassortants, we used parental viruses of equivalent fitness that differ only by non-coding nucleotide changes. These viruses were based on the isolate A/Panama/2007/1999 (H3N2). At a dose of 2x102 PFU, one parental virus was absent from each guinea pig throughout the time course, indicating the presence of a bottleneck. With an intermediate dose of 2x103 PFU, genomic diversity present in nasal lavage samples increased from 1-3 days post-infection (d.p.i.) and then declined by 6 d.p.i. With a high dose of 2x106 PFU, however, reassortment levels were high (avg. 59%) at 1 d.p.i. and remained stable. Even late in the course of infection, parental viruses were not eclipsed by reassortants, suggesting that a uniformly high multiplicity of infection was not achieved in vivo. Inoculation with approximately 10-fold discordant doses did not reduce reassortment relative to equivalent inputs, but markedly changed the spectrum of genotypes produced. Our data reveal the potential for reassortment to contribute to intra-host diversity in mixed influenza virus infection.

    Importance Influenza virus reassortment is prevalent in nature and is a major contributor to the diversity of influenza viruses circulating in avian, swine, human and other host species. This diversity, in turn, increases the potential for influenza viruses to evade selective pressures or adapt to new host environments. As examples, reassortment was key to the emergence of the 1957, 1968 and 2009 pandemics; the unusually severe influenza epidemics of 2003, 1951 and 1947; and the rise in adamantane resistance among currently circulating human H3N2 viruses. Herein we reveal the diversity of viral genotypes generated over time in a host co-infected with two influenza viruses. We find that intra-host diversity driven by reassortment is dynamic and dependent on the amount of each virus initiating infection. Our results demonstrate the readiness with which reassortant influenza viruses arise, offering new insight into this important mechanism of influenza virus evolution.

  • Herpes simplex virus protein kinases US3 and UL13 modulate VP11/12 phosphorylation, virion packaging and PI3-Kinase-Akt signaling activity [PublishAheadOfPrint]

  • The phosphotidylinositol 3-kinase (PI3K)/Akt signaling pathway plays key roles in diverse cellular activities and promotes cell growth and survival. It is therefore unsurprising that most viruses modify this pathway in order to facilitate their replication and spread. Previous work has suggested that the herpes simplex virus-1 (HSV-1) tegument proteins VP11/12 and US3 protein kinase modulate the PI3K/Akt pathway, albeit in opposing ways: VP11/12 binds and activates Src family kinases (SFKs), is tyrosine phosphorylated, recruits PI3K in a SFK-dependent fashion, and is required for HSV-induced phosphorylation of Akt on its activating residues; in contrast, US3 inhibits Akt activation and directly phosphorylates downstream Akt targets. We asked if US3 negatively regulates Akt by dampening the signaling activity of VP11/12. Consistent with this hypothesis, the enhanced Akt activation that occurs during US3-null infection requires VP11/12 and correlates with an increase in SFK-dependent VP11/12 tyrosine phosphorylation. In addition, deleting US3 leads to a striking increase in the relative abundance of several VP11/12 species that migrate with reduced mobility during SDS-PAGE. These forms arise through phosphorylation, strictly require the viral UL13 protein kinase, and are excluded from virions. Taken in combination, these data indicate that US3 dampens SFK- dependent tyrosine and UL13-dependent serine/threonine phosphorylation of VP11/12, thereby inhibiting VP11/12 signaling and promoting virion packaging of VP11/12. These results illustrate that protein phosphorylation events by viral protein kinases serve to coordinate the roles of VP11/12 as a virion component and intracellular signaling molecule.

    IMPORTANCE Herpesvirus tegument proteins play dual roles during the viral life cycle, serving both as structural components of the virus particle and as modulators of cellular and viral functions in infected cells. How these two roles are coordinated during infection and virion assembly is a fundamental and largely unanswered question. Here we address this issue with herpes simplex virus VP11/12, a tegument protein that activates the cellular PI3K/Akt signaling pathway. We show that protein phosphorylation mediated by the viral US3 and UL13 kinases serves to orchestrate its functions: UL13 appears to inhibit VP11/12 virion packaging, while US3 antagonizes UL13 action and independently dampens VP11/12 signaling activity.

  • Prolonged activity of the pestiviral RNase Erns as an interferon antagonist after uptake by clathrin-mediated endocytosis [PublishAheadOfPrint]

  • The RNase activity of the envelope glycoprotein Erns of the pestivirus bovine viral diarrhea virus (BVDV) is required to block interferon (IFN) type-I synthesis induced by ss- and dsRNA in bovine cells. Due to the presence of an unusual membrane anchor at its C-terminus, a significant portion of Erns is also secreted. In addition, a binding site for cell surface glycosaminoglycans is located within the C-terminal region of Erns. Here, we show that the activity of soluble Erns as an IFN antagonist is not restricted to bovine cells. Extracellularly applied Erns protein binds to cell surface glycosaminoglycans and is internalized into the cells within one hour of incubation by an energy-dependent mechanism that can be blocked by inhibitors of clathrin-dependent endocytosis. Erns mutants that lack the C-terminal membrane anchor retained RNase activity but lost most of its intracellular activity as IFN antagonist. Surprisingly, once taken up into the cells, Erns remains active to block dsRNA-induced IFN synthesis for several days. Thus, we propose that Erns acts as an enzymatically active decoy receptor that degrades extracellularly added viral RNA mainly in endolysosomal compartments that might otherwise activate intracellular pattern recognition receptors (PRRs) in order to maintain a state of innate immunotolerance.

    IMPORTANCE The pestiviral RNase Erns was previously shown to inhibit viral ss- and dsRNA-induced interferon (IFN) synthesis. However, the localization of Erns at or inside the cells, its species specificity and mechanism of interaction with cell membranes in order to block the hostrrsquo;s innate immune response are still largely unknown. Here, we provide strong evidence that the pestiviral RNase Erns is taken up within minutes by clathrin-mediated endocytosis, and that this uptake is mostly dependent on the glycosaminoglycan binding site located within the C-terminal end of the protein. Remarkably, the inhibitory activity of Erns remains active for several days, indicating the very potent and prolonged effect of a viral IFN antagonist. This novel mechanism of an "enzymatically active decoy receptor" that degrades a major viral pathogen-associated molecular pattern (PAMP) might be required to efficiently maintain innate and, thus, also adaptive immunotolerance, and it might well be relevant beyond the bovine species.

  • Anti-inflammatory cytokines directly inhibit innate but not adaptive CD8+ T cell functions [PublishAheadOfPrint]

  • Virus-specific CD8+ T cells provide classical adaptive immunity by responding to cognate peptide antigen, but they may also act in an "innate" capacity by responding directly to cytokine stimulation. Here, we examined regulation of these distinct T cell functions by anti-inflammatory cytokines (IL-4, IL-10, TGFbbeta;). Innate IFN production by CD8+ T cells following exposure to IL-12+IL-18, IL-12+TNFaalpha;, or IL-12+IL-15 was inhibited by exposure to anti-inflammatory cytokines either before or shortly after stimulation. However, inhibition was not universal, as other activation parameters, including upregulation of CD25 and CD69, remained largely unaltered. In contrast, peptide-specific T cell responses were resistant to inhibition by anti-inflammatory cytokines. This was not due to down-regulation of cytokine receptor expression or an inability to signal through cytokine receptors since phosphorylation of STAT proteins remained intact. These results highlight key differences in cytokine-mediated regulation of innate and adaptive T cell functions, which may help balance effective antiviral immune responses while reducing T cell-mediated immunopathology.

    Importance This study demonstrates key differences between the regulation of "innate" and "adaptive" CD8+ T cell functions following activation by innate cytokines or viral peptide. Innate production of IFN by CD8+ T cells following exposure to IL-12+IL-18, IL-12+TNFaalpha;, or IL-12+IL-15 was inhibited by exposure to anti-inflammatory cytokines (IL-4, IL-10, and TGFbbeta;). However, inhibition was not universal, as other activation parameters, including upregulation of CD25 and CD69, remained largely unaltered. In contrast, peptide-specific T cell responses were resistant to inhibition by anti-inflammatory cytokines. This distinct regulation of innate and adaptive T cell functions may serve to reduce T cell-mediated immunopathology while still allowing for effective antiviral responses at a site of infection.

  • NS2 proteins of GB virus B and hepatitis C virus share common protease activities and membrane topologies [PublishAheadOfPrint]

  • GB virus B (GBV-B), which is hepatotropic in experimentally infected small New World primates, is a member of the Hepacivirus genus but phylogenetically relatively distant to hepatitis C virus (HCV). To gain insight into the role and specificity of hepaciviral nonstructural protein 2 (NS2), which is required for HCV polyprotein processing and particle morphogenesis, we investigated whether NS2 structural and functional features are conserved between HCV and GBV-B. We found that GBV-B NS2, like HCV NS2, has a cysteine protease activity responsible for cleavage at the NS2/NS3 junction and we experimentally confirmed the location of this junction within the viral polyprotein. A model for GBV-B NS2 membrane topology was experimentally established by determining the membrane association properties of NS2 segments fused to GFP and their NMR structure using synthetic peptides, as well as by applying an N-glycosylation scanning approach. Similar glycosylation studies confirmed HCV NS2 organization. Together, our data show that despite limited amino acid sequence similarity, GBV-B and HCV NS2 share a common membrane topology with 3 N-terminal transmembrane segments, that is predicted to also apply to other recently discovered hepaciviruses. Based on these data and using trans-complementation systems, we found that intra-genotypic hybrid NS2 proteins with heterologous N-terminal membrane segments were able to trans-complement efficiently an assembly-deficient HCV mutant with a point mutation in the NS2 C-terminal domain, while GBV-B/HCV or inter-genotypic NS2 chimeras were not. These studies indicate that virus- and genotype-specific intramolecular interactions between N- and C-terminal domains of NS2 are critically involved in HCV morphogenesis.

    IMPORTANCE Nonstructural protein 2 (NS2) of hepatitis C virus (HCV) is a multifunctional protein critically involved in polyprotein processing and virion morphogenesis. To gain insight into NS2 mechanisms of action, we investigated whether NS2 structural and functional features are conserved between HCV and GB virus B (GBV-B), a phylogenetically relatively distant primate hepacivirus. We showed that GBV-B NS2, like HCV NS2, carries a cysteine protease activity. We experimentally established a model for GBV-B NS2 membrane topology and demonstrated that despite limited sequence similarity, GBV-B and HCV NS2 share a common organization with three N-terminal transmembrane segments. We found that the role of HCV NS2 in particle assembly is genotype-specific and relies on critical interactions between its N- and C-terminal domains. This first comparative analysis of NS2 from two hepaciviruses and our structural predictions of NS2 from other newly identified mammal hepaciviruses highlight conserved key features of the hepaciviral life cycle.

  • Global genomic diversity of human papillomavirus type 6 (HPV6) based on 724 isolates and 190 complete genome sequences [PublishAheadOfPrint]

  • Human papillomavirus type 6 (HPV6) is the major etiological agent of anogenital warts and laryngeal papillomas and has been included in both the quadrivalent and nonavalent prophylactic HPV vaccines. This study investigated global genomic diversity of HPV6 on 724 isolates and 190 complete genomes from six continents and the association of HPV6 genomic variants with geographical location, anatomical site of infection/disease and gender. Initially, a 2,800 bp E5a-E5b-L1-LCR fragment was sequenced from 492/530 (92.8%) HPV6 positive samples collected for this study. Out of them, 130 exhibited at least one single nucleotide polymorphisms (SNP), indel or amino acid change in the E5a-E5b-L1-LCR fragment and were sequenced in full-length. A global alignment and maximum likelihood tree of 190 HPV6 complete genomes (130 fully sequenced in this study and 60 from sequence repositories) revealed two variant lineages: A and B, and five B sublineages: B1, B2, B3, B4 and B5. HPV6 (sub)lineage-specific SNPs and a 960-bp representative region for whole-genome-based phylogenetic clustering within L2 open reading frame were identified. Multivariate logistic regression analysis revealed that lineage B predominated globally. Sublineage B3 was more common in Africa and North and South America and lineage A in Asia. Sublineages B1 and B3 were associated with anogenital infections, indicating a potential lesion-specific predilection of some HPV6 sublineages. Females had higher odds for infection with sublineage B3 than males. In conclusion, global HPV6 phylogenetic analysis revealed the existence of two variant lineages and five sublineages, showing some degree of ethnogeographic, gender and/or disease predilection in their distribution.

    IMPORTANCE This study established the largest database of globally circulating HPV6 genomic variants and contributed a total of 130 new HPV6 complete genome sequences to available sequence repositories. Two HPV6 variant lineages and five sublineages were identified and showed some degree of association with geographical location, anatomical site of infection/disease and/or gender. We additionally identified several HPV6 lineage and sublineage-specific SNPs to facilitate the identification of HPV6 variants and determined a representative region within L2 gene suitable for HPV6 whole-genome-based phylogenetic analysis. This study complements and significantly expands the current knowledge of HPV6 genetic diversity and forms a comprehensive basis for future epidemiological, evolutionary, functional, pathogenicity, vaccination and molecular assay development studies.

  • Vaccination with gene fragments of gag, vif, and nef affords partial control of viral replication after mucosal challenge with SIVmac239 [PublishAheadOfPrint]

  • Broadly-targeted cellular immune responses are thought to be important for controlling replication of human and simian immunodeficiency virus (HIV and SIV). However, eliciting such responses by vaccination is complicated by immunodominance mmdash; the preferential targeting of only a few of the many possible epitopes in a given antigen. This phenomenon may be due to the co-expression of dominant and subdominant epitopes by the same antigen presenting cell and may be overcome by distributing these sequences among several different vaccine constructs. Accordingly, we tested whether vaccinating rhesus macaques with "minigenes" encoding fragments of Gag, Vif, and Nef resulted in broadened cellular responses capable of controlling SIV replication. We delivered these minigenes through combinations of recombinant (r) rBCG, electroporated recombinant DNA (rDNA) along with an IL-12-expressing plasmid (EP rDNA + pIL-12), yellow fever vaccine virus 17D (rYF17D), and rAdenovirus serotype-5 (rAd5). Although priming with EP rDNA + pIL-12 increased the breadth of vaccine-induced T-cell responses, this effect was likely due to the improved antigen delivery afforded by electroporation, rather than modulation of immunodominance. Indeed, Mamu-A*01+ vaccinees mounted CD8+ T-cells directed against only one subdominant epitope, regardless of the vaccination regimen. After challenge with SIVmac239, vaccine efficacy was limited to a modest reduction in setpoint in some of the groups and did not correlate with standard T-cell measurements. These findings suggest that broad T-cell responses elicited by conventional vectors may not be sufficient to substantially contain AIDS virus replication.

    IMPORTANCE Immunodominance poses a major obstacle to the generation of broadly-targeted, HIV-specific cellular responses by vaccination. Here we attempted to circumvent this phenomenon and thereby broaden the repertoire of SIV-specific cellular responses by vaccinating rhesus macaques with minigenes encoding fragments of Gag, Vif, and Nef. In contrast to previous mouse studies, this strategy appeared to minimally affect monkey CD8+ T-cell immundominance hierarchies, as seen by the detection of only one subdominant epitope in Mamu-A*01+ vaccinees. This finding underscores the difficulty of inducing subdominant CD8+ T-cells by vaccination and demonstrates that strategies other than gene fragmentation may be required to significantly alter immunodominance in primates. Although some of the regimens tested here were extremely immunogenic, vaccine efficacy was limited to a modest reduction in setpoint viremia after challenge with SIVmac239. No correlates of protection were identified. These results reinforce the notion that vaccine immunogenicity does not predict control of AIDS virus replication.

  • Kaposi's Sarcoma-Associated Herpesvirus-Encoded LANA Interacts with Host KAP1 to Facilitate Establishment of Viral Latency [PublishAheadOfPrint]

  • Kaposi's sarcoma-associated herpesvirus (KSHV) typically displays two different phases in its life cycle, including the default latent phase as well as the lytic phase. There is a short period of lytic gene expression at the early stage of KSHV primary infection. The factors involved in the shutdown process of lytic gene expression are poorly identified. It has been shown that the latency-associated nuclear antigen (LANA) encoded by KSHV plays an important role in the establishment of viral latency. In screening, we identified a host protein, Kruuuml;ppel-associated box domain associated protein-1 (KAP1) that bound to LANA. We validated the interaction between LANA and KAP1 in vivo and in vitro as well as their colocalization in the nucleus. We mapped out that LANA interacted with both the N- and C-terminal domains of KAP1. Based on the determined interface of LANA-KAP1 interaction, we proved that LANA recruited KAP1 to the RTA promoter region of the KSHV genome. We revealed that KAP1 was involved in transcriptional repression by LANA. We found that multiple co-occupation sites of LANA and KAP1 on the whole KSHV genome by ChIP-seq and demonstrated that LANA-recruited KAP1 played a critical role in the shutdown of lytic gene expression during the early stage of KSHV primary infection. Taken together, our data suggest that LANA interacts with KAP1 and represses lytic gene expression to facilitate the establishment of KSHV latency.

    Importance Our study revealed the mechanism of transcriptional repression by LANA during KSHV primary infection, providing new insights into the process of KSHV latency establishment.

  • Small Molecule Probes Targeting the Viral PPxY-Host Nedd4 Interface Block Egress of a Broad Range of RNA Viruses [PublishAheadOfPrint]

  • Budding of filoviruses, arenaviruses, and rhabdoviruses is facilitated by subversion of host proteins, such as Nedd4 E3 ubiquitin ligase, by viral PPxY late (L) budding domains expressed within the matrix proteins of these RNA viruses. As L domains are important for budding and are highly conserved in a wide array of RNA viruses, they represent potential broad-spectrum targets for the development of antiviral drugs. To identify potential competitive blockers, we used the known Nedd4 WW-domain/PPxY interaction interface as the basis of an in silico screen. Using PPxY-dependent budding of Marburg (MARV) VP40 virus-like particles (VLPs) as our model system, we identified small molecule hit 1 that inhibited Nedd4-PPxY interaction and PPxY-dependent budding. This lead candidate was subsequently improved with additional structure-activity relationship (SAR) analog testing which enhanced anti-budding activity into the nanomolar range. Current leads 4 and 5 exhibit on-target effects by specifically blocking the MARV VP40 PPxY-host Nedd4 interaction and subsequent PPxY-dependent egress of MARV VP40 VLPs. In addition, leads 4 and 5 exhibited anti-budding activity against Ebola and Lassa fever VLPs, as well as vesicular stomatitis (VSV) and rabies (RABV) viruses. These data provide target validation and suggest that inhibition of the PPxY-Nedd4 interaction can serve as the basis for the development of a novel class of broad-spectrum, host-oriented antivirals targeting viruses that depend on a functional PPxY L domain for efficient egress.

    Importance: There is an urgent and unmet need for the development of safe and effective therapeutics against biodefense and high priority pathogens, including filoviruses (Ebola and Marburg) and arenaviruses (e.g. Lassa and Junin) which cause severe hemorrhagic fever syndromes with high mortality rates. We and others have established that efficient budding of filoviruses, arenaviruses and others is critically dependent on the subversion of host proteins. As disruption of virus budding would prevent virus dissemination, identification of small molecule compounds that block these critical viral-host interactions should effectively block disease progression and transmission. Our findings provide validation for targeting these virus-host interactions, as we have identified lead inhibitors with broad-spectrum antiviral activity. In addition, such inhibitors might prove useful for newly emerging RNA viruses for which no therapeutics would be available.

  • KSHV encoded LANA can induce chromosomal instability through targeted degradation of the mitotic checkpoint kinase Bub1 [PublishAheadOfPrint]

  • Kaposi's sarcoma-associated herpesvirus (KSHV) has a significant contributory role in the development of three major human neoplastic or lymphoproliferative diseases, Kaposi's sarcoma (KS), primary effusion lymphoma (PEL), and multicentric Castleman's disease (MCD). These diseases are associated with chromosomal instability, a hallmark of human cancer. The latency-associated nuclear antigen (LANA) encoded by KSHV plays a key role in regulating a number of cellular pathways critical for oncogenesis. KSHV LANA alone can induce the development of B cell hyperplasia and lymphoma in mice expressing LANA. LANA also induces chromosomal instability thus promoting oncogenesis. However, the precise mechanism underlying LANA-mediated chromosomal instability remains uncharted. Here we report that LANA promoted induction of chromosomal instability and the formation of micronuclei and multinucleation through its interaction and resulting degradation of one of the critical spindle checkpoint proteins Bub1. This interaction occurs through the Knl and Kinase domains of Bub1 identified to be important for stability and degradation. These results suggest that LANA can dysregulate Bub1 activity which leads to aberrant chromosome replication and aneuploidy, thus contributing to KSHV-mediated oncogenesis.

    Importance: This work represents the first set of results identifying a novel mechanism which shows that LANA, a latent antigen encoded by KSHV, can induce the degradation of Bub1, a spindle checkpoint protein which is important for spindle checkpoint signaling and chromosome segregation. The down-regulation of Bub1 mediated by LANA resulted in chromosomal instability, a hallmark of cancer. We further investigated the specific domains of Bub1 that are required for the interaction between LANA and Bub1. The results demonstrated that the Knl and Kinase domains of Bub1 are required for interaction between LANA and Bub1. In addition, we also investigated the mechanism by which LANA promoted Bub1 degradation. Our results showed that LANA physically interacted with the anaphase-promoting complex (APC/C), thus promoting degradation of Bub1 in a ubiquitin-dependent process.

  • Analysis of Lujo virus cell entry using pseudotype vesicular stomatitis virus [PublishAheadOfPrint]

  • Several arenaviruses are known to cause viral hemorrhagic fever (VHF) in Sub-Saharan Africa and South America, where VHF is a major public health and medical concern. The biosafety level four categorization of these arenaviruses restricts their use and has impeded biological studies, including therapeutic drug and/or vaccine development. Due to difficulties associated with handling live viruses, pseudotype viruses, which transiently bear arenavirus envelope proteins based on vesicular stomatitis virus (VSV) or retrovirus, have been developed as surrogate virus systems. Here, we report the development of a pseudotype VSV bearing each envelope protein of various species of arenaviruses (AREpv), including the newly identified Lujo virus (LUJV) and Chapare virus. Pseudotype arenaviruses generated in 293T cells exhibited high infectivity in various mammalian cell lines. The infections of New World and Old World AREpv were dependent on their receptors (human transferrin receptor 1 (hTfR1) and aalpha;-dystroglycan (aalpha;DG), respectively). However, the infection of pseudotype VSV bearing the LUJV envelope protein (LUJpv) occurred independently of hTfR1 and aalpha;DG, indicating that LUJpv utilizes an unidentified receptor. The pH-dependent endocytosis of AREpv was confirmed by the use of lysosomotropic agents. The cell fusion of cells expressing these envelope proteins, except for those expressing the LUJV envelope protein, was induced by transient treatment at low pH values. LUJpv infectivity was inhibited by U18666A, a cholesterol transport inhibitor. Furthermore, the infectivity of LUJpv was significantly decreased in the Niemann-Pick C1 (NPC1) deficient cell line, suggesting the necessity of NPC1 activity for efficient LUJpv infection.

    Importance LUJV is a newly identified arenavirus associated with a VHF outbreak in southern Africa. Although cell entry for many arenaviruses have been studied, cell entry for LUJV have not been characterized. In this study, we found that LUJpv utilizes neither aalpha;DG nor hTfR1 as receptor and unique characteristics of LUJV glycoprotein in membrane fusion and cell entry. Proper exclusion of cholesterol or some kinds of lipids may play important roles in the LUJpv cell entry.

  • Cellular transcriptome analysis reveals differential expression of pro- and anti-apoptosis genes by Varicella zoster virus-infected neurons and fibroblasts [PublishAheadOfPrint]

  • Transcriptional changes following VZV infection of cultured human neurons derived from embryonic stem cells were compared to those in VZV-infected human foreskin fibroblasts. Transcription of 340 neuronal genes significantly altered by VZV infection included 223 transcript changes unique to neurons. Strikingly, genes inhibiting apoptosis were up-regulated in neurons, while pro-apoptotic gene transcription was increased in fibroblasts. This data is a basis for discovery of differences in virus-host interactions between these VZV targets.

  • Evolution of puma lentivirus in bobcats (Lynx rufus) and mountain lions (Puma concolor) in North America [PublishAheadOfPrint]

  • Mountain lions (Puma concolor) throughout North and South America are infected with puma lentivirus B (PLVB). A second, highly divergent lentiviral clade, PLVA, infects mountain lions in southern California and Florida. Bobcats in these two geographic regions are also infected with PLVA, and to date, this is the only strain of lentivirus identified in bobcats. We sequenced full-length PLV genomes in order to characterize the molecular evolution of PLV in bobcats and mountain lions. Low sequence homology (88% average pairwise identity) and frequent recombination (one recombination break point per three isolates analyzed) were observed in both clades. Viral proteins have markedly different patterns of evolution; sequence homology and negative selection were highest in Gag and Pol, and lowest in Vif and Env. 1.7% of sites across the PLV genome evolve under positive selection, indicating host-imposed selection pressure is an important force shaping PLV evolution. PLVA viruses are highly spatially structured reflecting the population dynamics of their primary host - the bobcat. In contrast, the phylogeography of PLVB reflects the highly mobile mountain lion, with diverse PLVB isolates co-circulating in some areas and genetically related viruses present in populations separated by thousands of kilometers. We conclude that PLVA and PLVB are two different viral species with distinct feline hosts and evolutionary histories.

    IMPORTANCE Understanding viral evolution in natural host populations is a fundamental goal of virology, molecular biology, and disease ecology. Here we provide a detailed analysis of puma lentivirus (PLV) evolution in two natural carnivore hosts, the bobcat and mountain lion. Our results illustrate that PLV evolution is a dynamic process that results from high rates of viral mutation/recombination and host-imposed selection pressure.

  • Hepatitis Delta Antigen Requires a Flexible Quasi-Double-Stranded RNA Structure to Bind and Condense Hepatitis Delta Virus RNA in a Ribonucleoprotein Complex [PublishAheadOfPrint]

  • The circular genome and antigenome RNAs of hepatitis delta virus (HDV) form characteristic unbranched, quasi-double-stranded RNA secondary structures in which short double-stranded helical segments are interspersed with internal loops and bulges. The ribonucleoprotein complexes (RNPs) formed by these RNAs with the virally encoded protein, hepatitis delta antigen (HDAg), perform essential roles in the viral life cycle, including viral replication and virion formation. Little is understood about the formation and structure of these complexes and how they function in these key processes. Here, the specific RNA features required for HDAg binding and the topology of the complexes formed was investigated. Selective 2'OH acylation analyzed by primer extension (SHAPE) applied to free and HDAg-bound HDV RNAs indicated that the characteristic secondary structure of the RNA is preserved when bound to HDAg. Notably, the analysis indicated that predicted unpaired positions in the RNA remained dynamic in the RNP. Analysis of the in vitro binding activity of RNAs in which internal loops and bulges were mutated and of synthetically designed RNAs demonstrated that the distinctive secondary structure, not the primary RNA sequence, is the major determinant of HDAg RNA binding specificity. Atomic force microscopy analysis of RNPs formed in vitro revealed complexes in which the HDV RNA is substantially condensed by bending or wrapping. Our results support a model in which the internal loops and bulges in HDV RNA contribute flexibility to the quasi-double-stranded structure that allows RNA bending and condensing by HDAg.

    IMPORTANCE RNA-protein complexes (RNPs) formed by the hepatitis delta virus RNAs and protein, HDAg, perform critical roles in virus replication. Neither the structures of these RNPs nor the RNA features required to form them have been characterized. HDV RNA is unusual in that it forms an unbranched quasi-double-stranded structure in which short base-paired segments are interspersed with internal loops and bulges. We analyzed the role of the HDV RNA sequence and secondary structure in the formation of a minimal RNP and visualized the structure of this RNP using atomic force microscopy. Our results indicate that HDAg does not recognize the primary sequence of the RNA; rather, the principle contribution of unpaired bases in HDV RNA to HDAg binding is to allow flexibility in the unbranched quasi-double-stranded RNA structure. Visualization of RNPs by atomic force microscopy indicated that the RNA is significantly bent or condensed in the complex.

  • Expanded Host Diversity and Geographic Distribution of Hantaviruses in Sub-Saharan Africa [PublishAheadOfPrint]

  • Recent discovery of hantaviruses in shrews and bats in West Africa suggests that other genetically distinct hantaviruses exist in East Africa. Genetic and phylogenetic analyses of newfound hantaviruses, detected in archival tissues from the Geata mouse shrew (Myosorex geata) and Kilimanjaro mouse shrew (Myosorex zinki) captured in Tanzania, expands the host diversity and geographic distribution of hantaviruses and suggests that ancestral shrews and/or bats may have served as the original mammalian hosts of primordial hantaviruses.

  • Liquefaction of Semen Generates and Later Degrades a Conserved Semenogelin Peptide that Enhances HIV Infection [PublishAheadOfPrint]

  • Semen enhances HIV infection in vitro, but how long it retains this activity has not been carefully examined. Immediately post-ejaculation semen exists as a semi-solid coagulum, which then converts to a more liquid form in a process termed liquefaction. We demonstrate that early during liquefaction, semen exhibits maximal HIV-enhancing activity that gradually declines upon further incubation. The decline in HIV-enhancing activity parallels degradation of peptide fragments derived from the semenogelins (SEMs(, the major components of the coagulum that are cleaved in a site-specific and progressive manner upon initiation of liquefaction. Because amyloid fibrils generated from SEM fragments were recently demonstrated to enhance HIV infection, we set out to determine whether any of the liquefaction-generated SEM fragments associate with the presence of HIV-enhancing activity. We identify SEM1(86mmdash;107) as a short, cationic, amyloidogenic SEM peptide that is generated early in the process of liquefaction, but conversely is lost during prolonged liquefaction due to the activity of serine proteases. Synthetic SEM1(86mmdash;107) amyloids directly bind HIV-1 virions and are sufficient to enhance HIV infection of permissive cells. Furthermore, endogenous seminal levels of SEM1(86mmdash;107) correlate with donor-dependent variations in viral enhancement activity, and antibodies generated against SEM1(86mmdash;107) recognize endogenous amyloids in human semen. The amyloidogenic potential of SEM1(86mmdash;107) and its virus-enhancing properties are conserved amongst great apes, suggesting an evolutionarily conserved function. These studies identify SEM1(86mmdash;107) as a key, HIV-enhancing amyloid species in human semen, and underscore the dynamic nature of semen's HIV-enhancing activity.

    Importance Semen, the most common vehicle for HIV transmission, enhances HIV infection in vitro, but how long it retains this activity has not been investigated. Semen naturally undergoes physiological changes over time, whereby it converts from a gel-like consistency to a more liquid form. This process, termed liquefaction, is characterized at the molecular level by site-specific and progressive cleavage of SEMs, the major components of the coagulum, by seminal proteases. We demonstrate that the HIV-enhancing activity of semen gradually decreases over the course of extended liquefaction, and identify a naturally-occurring semenogelin-derived fragment, SEM1(86mmdash;107), whose levels correlate with viral enhancing activity over the course of liquefaction. SEM1(86mmdash;107) amyloids are naturally present in semen, and synthetic SEM1(86mmdash;107) fibrils bind virions and are sufficient to enhance HIV infection. Therefore, by characterizing dynamic changes in the HIV-enhancing activity of semen during extended liquefaction, we identified SEM1(86mmdash;107) as a key viral-enhancing component of human semen.

  • The characteristics of nucleocytoplasmic transport of H1N1 influenza A viruses nuclear export protein (NEP) [PublishAheadOfPrint]

  • The influenza A virus nuclear export protein (NEP) plays crucial roles in the nuclear export of the viral ribonucleoprotein complex through the CRM1-mediated cellular protein transport system. However, the detailed mechanism of NEP nucleocytoplasmic trafficking remain incompletely understood. Here, we investigated the subcellular localization of NEP from two strains of H1N1 influenza A virus and found that 2009 swine-origin H1N1 influenza A virus A/California/04/2009 (CA04) NEP displayed a distinct cellular distribution pattern, forming unique nuclear aggregates, compared to A/WSN/33 (H1N1) (WSN) NEP. Characterization of the nucleocytoplasmic transport pathways of these two NEPs showed that they both enter the nucleus by passive diffusion but are exported through the nuclear export receptor chromosome region maintenance 1 (CRM1)-mediated pathway with different efficiencies. The two identified NESs on both NEPs functioned similarly despite differences in their amino acid sequences. Using a two-hybrid assay, we confirmed that the CA04 NEP interacts less efficiently with CRM1, and a threonine residue at position 48 is responsible for the nuclear aggregation. The present study revealed the dissimilarity in subcellular NEP transport processes between the 2009 pandemic (H1N1) influenza A virus CA04 and lab-adapted H1N1 virus WSN and uncovered the mechanism for this difference.

    Importance Because the efficiency of the nucleocytoplasmic transport of viral components is often correlated with the viral RNA polymerase activity, propagation, and host range of influenza viruses, the present study investigated the subcellular localization of NEP from two strains of H1N1 influenza virus. We found that both the NEPs of A/California/04/2009 (H1N1) (CA04) and A/WSN/33 (H1N1) (WSN) enter the nucleus by passive diffusion but are exported with different efficiencies, which was caused by weaker binding activity between the CA04 NEP and CRM1. The results of the present study revealed characteristics of the nuclear import and export pathways of NEP and mechanism for the difference in cellular distribution of NEP between two H1N1 strains.

  • ENHANCED VIRAL REPLICATION AND MODULATED INNATE IMMUNE RESPONSES IN INFANT AIRWAY EPITHELIUM FOLLOWING H1N1 INFECTION [PublishAheadOfPrint]

  • Influenza is the cause of significant morbidity and mortality in pediatric populations. The contribution of pulmonary host defense mechanisms to viral respiratory infection susceptibility in very young children is poorly understood. As a surrogate to compare mucosal immune responses for infant and adult lung, rhesus monkey primary airway epithelial cell cultures were infected with pandemic influenza A/H1N1 in vitro. Virus replication, cytokine secretion, cell viability and type I interferon (IFN) pathway PCR array profiles were evaluated for both infant and adult cultures. In comparison with adult cultures, infants showed significantly increased levels of H1N1 replication, reduced IFN-alpha protein synthesis and no difference in cell death following infection. Age-dependent differences in expression of multiple genes associated with the type I IFN pathway were observed in H1N1-infected cultures. To investigate the pulmonary and systemic response to H1N1 infection in early life, infant monkeys were inoculated with H1N1 by upper airway administration. Animals were monitored over a 14 day period for virus and parameters of inflammation. High H1N1 titers were recovered from airways at day 1, with viral RNA remaining detectable until day 9 post infection. Despite viral clearance, bronchiolitis and alveolitis persisted at day 14 post infection; histopathologic analysis revealed alveolar septal thickening and intermittent type II pneumocyte hyperplasia. Our overall findings are consistent with the known susceptibility of respiratory virus infection in pediatric populations and suggest that intrinsic developmental differences in airway epithelial cell immune function may contribute to the limited efficacy of host defense during early childhood.

    IMPORTANCE To the best of our knowledge, this study represents the first report of intrinsic developmental differences in infant airway epithelial cells that may contribute to increased susceptibility of the host to respiratory virus infections. Despite the global burden of influenza, there are currently no vaccine formulations approved for children less than 6 months of age. Given the challenges of conducting experimental studies involving pediatric patients, rhesus monkeys are an ideal laboratory animal model to investigate the maturation of pulmonary mucosal immune mechanisms during early life because they are most similar to humans with regard to postnatal maturation of lung structure and the immune system. Thus, our findings are highly relevant to translational medicine and these data may ultimately lead to novel approaches that enhance airway immunity in the very young.

  • Lack of significant elevation of myeloid-derived suppressor cells in peripheral blood of chronically HCV infected individuals [PublishAheadOfPrint]

  • Myeloid-derived suppressor cells (MDSC) are immature myeloid cells with immunosuppressive function. Compared to healthy controls(HC), no elevation of MDSC in chronic hepatitis-C(cHEP-C) was found, independent of genotype or viral load (pggt;0.25). Moreover, MDSC of cHEP-C inhibited CD8 T cell function as efficiently as MDSC of HC did. Since we detected neither quantitative nor qualitative differences to MDSC of HC we postulate that MDSC in peripheral blood are most likely not significant regarding immune-dysfunction in cHEP-C.

  • Interspecies differences in virus uptake versus cardiac function of the coxsackievirus and adenovirus receptor (CAR). [PublishAheadOfPrint]

  • The coxsackievirus and adenovirus receptor (CAR) is a cell contact protein with an important role in virus uptake. Its extracellular immunoglobulin domains mediate the binding to coxsackie and adenoviruses as well as homophilic and heterophilic interactions between cells. The cytoplasmic tail links CAR to the cytoskeleton and intracellular signaling cascades. In the heart, CAR is crucial for embryonic development, electrophysiology, and coxsackievirus B infection. Non-cardiac functions are less well understood, in part due to the lack of suitable animal models. Here we generated a transgenic mouse that rescued the otherwise embryonic lethal CAR-knockout (KO) phenotype by expressing chicken CAR exclusively in the heart. Using this rescue model we addressed interspecies differences in coxsackievirus uptake and non-cardiac functions of CAR. Survival of the non-cardiac CAR KO mouse (ncKO) indicates an essential role for CAR in the developing heart, but not in other tissues. In adult animals cardiac activity was normal, suggesting that chicken CAR can replace the physiological functions of mouse CAR in the cardiomyocyte. However, chicken CAR did not mediate virus entry in vivo so that hearts expressing chicken- instead of mouse CAR were protected from infection and myocarditis. Comparison of sequence homology and modeling of the D1 domain indicate differences between mammalian and chicken CAR that relate to the sites important for virus binding but not those involved in homodimerization. Thus, CAR-directed anti-coxsackieviral therapy with only minor adverse effects in non-cardiac tissue could be further improved by selectively targeting the virus-host interaction while maintaining cardiac function.

    Importance Coxsackievirus B3 (CVB3) is one of the most common human pathogens causing myocarditis. Its receptor CAR does not only mediate virus uptake but also relates to cytoskeletal organization and intracellular signaling. Animals without CAR die prenatally with major cardiac malformations. In the adult heart CAR is important for virus entry and electrical conduction, but its non-muscle functions are largely unknown. Here we show that chicken CAR expression exclusively in the heart can rescue the otherwise embryonic lethal CAR knockout phenotype but does not support CVB3 infection of adult cardiomyocytes. Our findings have implication for the evolution of virus/host versus physiological interactions involving CAR and could help to improve future coxsackievirus directed therapies inhibiting virus replication while maintaining CAR's cellular functions.

  • Within-host whole genome deep sequencing and diversity analysis of human RSV infection reveals dynamics of genomic diversity in the absence and presence of immune pressure [PublishAheadOfPrint]

  • Human respiratory syncytial virus (RSV) is the leading cause of lower respiratory tract disease in infants and young children, and an important respiratory pathogen in the elderly and immunocompromised. While population-wide molecular epidemiology studies have shown multiple co-circulating RSV genotypes and revealed antigenic and genetic change over successive seasons, little is known about the extent of viral diversity over the course of an individual infection, the origins of novel variants, or the effect of immune pressure on viral diversity and potential immune-escape mutations. To investigate viral population diversity in the presence and absence of selective immune pressures, we studied whole genome deep sequencing of RSV in upper airway samples from an infant with severe combined immune deficiency syndrome and persistent RSV infection. The infection continued over several months before and after bone marrow transplant (BMT) from his RSV-immune father. RSV diversity was characterized in 26 samples obtained over 78 days. Diversity increased after engraftment, as defined by T-cell presence, and populations reflected variation mostly within the G protein, the major surface antigen. Minority populations with known palivizumab-resistance mutations emerged after its administration. The viral population appeared to diversify in response to selective pressures, showing a statistically significant growth in diversity in the presence of pressure from immunity. Defining escape mutations and their dynamics will be useful in the design and application of novel therapeutics and vaccines. These data can contribute to future studies of the relationship between within-host and population-wide RSV phylodynamics.

    Importance Human respiratory syncytial virus (RSV) is an important cause of respiratory disease in infants, the elderly, and the immunocompromised. RSV circulating in a community appears to change season by season, but the amount of diversity generated during an individual infection and the impact of immunity on this viral diversity has been unclear. To address this question, we described within-host RSV diversity by whole genome deep sequencing in a unique clinical case of an RSV-infected infant with severe combined immunodeficiency and effectively no adaptive immunity who then gained adaptive immunity after undergoing bone marrow transplantation. We found that viral diversity increased in the presence of adaptive immunity and was primarily within the G protein, the major surface antigen. These data will be useful in designing RSV treatments and vaccines, and help understand the relationship between the dynamics of viral diversification within individual hosts and the viral populations circulating in a community.

  • Outer membrane protein OmpW is the receptor of typing phage VP5 of Vibrio cholerae O1 El Tor biotype [PublishAheadOfPrint]

  • Phage-typing is used for the subtyping of epidemic clones of bacteria. In this study we identified the outer membrane protein OmpW as the receptor of phage VP5, one of the typing phages for Vibrio cholerae O1 El Tor biotype. The characteristic 11-bp deletion in ompW was observed in all epidemic strains resistant to VP5, suggesting that this mutation event can be used as a tracing marker in cholera surveillance.

  • Association of satellites with a mastrevirus in natural infection: complexity of Wheat dwarf India virus disease [PublishAheadOfPrint]

  • In contrast to begomoviruses, mastreviruses have not previously been shown to interact with satellites. This manuscript reports the first identification of the association of satellites with a mastrevirus in field-grown plants. Two alphasatellite species were detected in different field samples of wheat infected with Wheat dwarf India virus (WDIV) - one Cotton leaf curl Multan alphasatellite (CLCuMA) and the other Guar leaf curl alphasatellite (GLCuA). In addition to the alphasatellites, a betasatellite, Ageratum yellow leaf curl betasatellite (AYLCB), was also identified in the wheat samples. No begomovirus was detected in the wheat samples, thus establishing association of the above satellites with WDIV. Agrobacterium-mediated inoculation of WDIV in wheat, in the presence of either of the alphasatellites or the betasatellite, resulted in infections inducing more severe symptoms. WDIV efficiently maintained each of the alphasatellites and the betasatellite in wheat. The satellites enhanced the level of WDIV DNA in wheat. Inoculation of the satellites isolated from wheat with various begomoviruses into Nicotiana tabacum demonstrated that these remain capable of interacting with the viruses with which they were first identified. Virus-specific small RNAs accumulated in wheat upon infection with WDIV but were lower in abundance in plants co-infected with the satellites, suggesting that both the alphasatellites and the betasatellite suppress RNA silencing. These results suggest that the selective advantage for the maintenance of the alphasatellites and the betasatellite by WDIV in the field is in overcoming RNA silencing-mediated host defense.

    IMPORTANCE Wheat is the most widely cultivated cereal crop in the world. A number of viruses are important pathogens of wheat, including the viruses of genus Mastrevirus, family Geminiviridae. This study reports the association of sub-genomic components, called satellites (alpha- and betasatellites), with a mastrevirus, Wheat dwarf India virus (WDIV), isolated from two distant locations in India. This manuscript reports the first identification of the satellites in a monocot plant. The satellites enhanced accumulation of WDIV and severity of disease symptoms. The satellites lowered the concentration of virus-specific small RNAs in wheat plants, indicating their silencing suppressor activity. The involvement of the satellites in symptom severity of the mastrevirus can have implications in the form of economic impact of the virus on crop yield. Understanding the role of the satellites in disease severity is important for developing disease management strategies.

  • INCORPORATION OF MOUSE APOBEC3 INTO MuLV VIRIONS DECREASES THE ACTIVITY AND FIDELITY OF REVERSE TRANSCRIPTASE [PublishAheadOfPrint]

  • APOBEC3 proteins are restriction factors that induce G -ggt; A hypermutation in retroviruses during replication as a result of cytidine deamination of minus strand DNA transcripts. However, the mechanism of APOBEC inhibition of MuLVs does not appear to be G-ggt;A hypermutation and is unclear. In this report the incorporation of mA3 in virions resulted in a loss in virion reverse transcriptase (RT) activity and RT fidelity that correlated with the loss of virion specific infectivity,

  • Kaposi's sarcoma-associated herpesvirus ORF45 mediates transcriptional activation of the HIV-1 LTR via RSK2 [PublishAheadOfPrint]

  • Robust activation of HIV-1 gene expression occurs upon superinfection with Kaposi's sarcoma-associated herpesvirus (KSHV), a common AIDS-associated pathogen. Though the mechanisms underlying this phenotype remain unknown, several KSHV encoded factors have been reported to stimulate HIV-1 long terminal repeat (LTR) activity. Here, we systematically evaluated the ability of KSHV tegument proteins to modulate activation of an integrated HIV-1 LTR and reveal that the most potent individual activator is ORF45. ORF45 directs an increase in RNA polymerase II recruitment to the HIV-1 LTR, leading to enhanced transcriptional output. ORF45 is a robust activator of the p90 ribosomal S6 kinases (RSK), and we find that this activity is necessary but not sufficient to increase transcription from the LTR. Of the three widely expressed RSK isoforms, RSK2 appears selectively involved in LTR stimulation by both KSHV ORF45 and HIV-1 Tat. However, constitutively active RSK2 is unable to stimulate the LTR, suggesting that ORF45 may preferentially direct this kinase to a specific set of targets. Collectively, our findings reveal a novel transcriptional activation function for KSHV ORF45, and highlight the importance of RSK2 in shaping the transcriptional environment during infection.

    IMPORTANCE Kaposi's sarcoma-associated herpesvirus (KSHV) is a prominent AIDS-associated pathogen. Previous studies have shown that infection of cells containing human immunodeficiency virus 1 (HIV-1) with KSHV leads to potent stimulation of HIV-1 gene expression by activating the HIV-1 promoter, termed the LTR. Here, we compared the ability of various KSHV proteins to activate gene expression from the HIV-1 LTR and found that KSHV ORF45 is the most potent activator. ORF45 is known to induce cell signaling through ribosomal S6 kinase (RSK) and enhance protein translation. However, we reveal that activation of a specific isoform of RSK by ORF45 also leads to increased messenger RNA synthesis from the LTR by the host RNA polymerase. Collectively, our findings provide new insight into the inter-viral interactions between KSHV and HIV that may ultimately impact disease.

  • N-Myc interactor (Nmi) inhibits prototype foamy virus by sequestering viral Tas protein in the cytoplasm [PublishAheadOfPrint]

  • Foamy viruses (FVs) are complex retroviruses that establish lifelong persistent infection without evident pathology. However, the roles of cellular factors in FV latency are poorly understood. This study revealed that N-Myc interactor (Nmi) could inhibit the replication of prototype foamy virus (PFV). Overexpression of Nmi reduced PFV replication, whereas its depletion by small interfering RNA increased PFV replication. The Nmi-mediated impairment of PFV replication resulted from the diminished transactivation by PFV Tas of the viral long terminal repeat (LTR) and an internal promoter (IP). Nmi was determined to interact with Tas and abrogate its function by sequestration in the cytoplasm. In addition, human and bovine Nmi proteins were found to inhibit the replication of bovine foamy virus (BFV) and PFV. Together, these results indicate that Nmi inhibits both human and bovine FVs by interfering with the transactivation function of Tas and may have a role in the host defense against FV infection.

    IMPORTANCE In this study, we report that the N-Myc interactor (Nmi), an interferon-induced protein, can interact with the regulatory protein Tas of the prototype foamy virus and sequester it in the cytoplasm. This study suggests that Nmi plays an important role in maintaining foamy virus latency and may reveal a new pathway in the interferon-mediated antiviral barrier against viruses. These findings are important for understanding virus-host relationships not only with FVs but potentially for other retroviruses as well.

  • Molecular insights on the recognition of a Lactococcus lactis cell wall pellicle by phage 1358 receptor binding protein [PublishAheadOfPrint]

  • The Gram+ bacterium Lactococcus lactis is used for the production of cheeses and other fermented dairy products. Fortuitous infection of L. lactis cells by virulent lactococcal tailed phages is one of the major risks of fermentation failures in industrial dairy factories. Lactococcal phage 1358 possesses a host range limited to a few L. lactis strains and strong genomic similarities to Listeria phages. We report here the X-ray structures of phage 1358 receptor binding protein (RBP) in complex with monosaccharides. Each monomer of its trimeric RBP is formed of two domains: a "shoulders" domain linking the RBP to the rest of the phage and a jelly-roll fold "head/host recognition" domain. This domain harbors a saccharide binding crevice located in the middle of a monomer. Crystal structures identified two sites at the RBP surface,~8 AAring; from each other, one accommodating a GlcNAc monosaccharide, the other a GlcNAc or a Glc1P monosaccharide. GlcNAc and GlcNAc1P are components of the polysaccharide pellicle that we identified at the cell surface of L. lactis SMQ-388, the host of phage 1358. We therefore modelled a Galf sugar bridging the two GlcNAc, suggesting that the trisaccharidic motif GlcNAc-Galf-GlcNAc (or Glc1P) might be common to receptors of genetically distinct lactococcal phages p2, TP901-1 and 1358. Strain specificity might therefore be elicited by steric clashes induced by the remaining components of the pellicle hexasaccharide. Taken together these results provide a first insight in the molecular mechanism of host receptor recognition by lactococcal phages.

    Importance section Siphophages infecting the gram+ bacterium Lactococcus lactis are sources of milk fermentation failures in the dairy industry. We report here the structure of the "pellicle" polysaccharide from L. lactis SMQ388, the specific host strain of phage 1358. We determined the X-ray structures of lytic lactococcal phage 1358 receptor binding protein (RBP) in complex with monosaccharides. The positions and nature of monosaccharides bound to the RBP is in agreement with the pellicle structure, and suggest a general binding mode of lactococal phages to their "pellicle" saccharidic receptor.

  • Interferon regulatory factor-1 restricts gammaherpesvirus replication in primary immune cells. [PublishAheadOfPrint]

  • Gammaherpesviruses are ubiquitous pathogens that establish a life-long infection and are associated with cancer. In spite of high seroprevalence of infection, the risk factors that predispose the host towards gammaherpesvirus-induced malignancies are still poorly understood. Interferon regulatory factor 1 (IRF-1) is a tumor suppressor that is also involved in the regulation of innate and adaptive immune responses. Based on its biology, IRF-1 represents a plausible host factor to attenuate gammaherpesvirus infection and tumorigenesis. In this study we show that IRF-1 restricts gammaherpesvirus replication in primary macrophages, a physiologically relevant immune cell type. In spite of the known role of IRF-1 in stimulating type I interferon (IFN) expression, induction of global type I IFN response was similar in IRF-1 deficient and proficient macrophages during gammaherpesvirus infection. However, IRF-1 was required for optimal expression of cholesterol-25-hydroxylase, a host enzyme that restricted gammaherpesvirus replication in primary macrophages and contributed to the antiviral effects of IRF-1. In summary, the current study provides an insight into the mechanism by which IRF-1 attenuates gammaherpesvirus replication in primary immune cells, a mechanism that is likely to contribute to antiviral effects of IRF-1 in other virus systems.

    Significance Interferon regulatory factor 1 (IRF-1) is a transcription factor that regulates innate and adaptive immune responses and functions as a tumor suppressor. IRF-1 restricts replication of diverse viruses; however, the mechanisms responsible for antiviral effects of IRF-1 are still poorly understood. Gammaherpesviruses are ubiquitous pathogens that are associated with induction of several malignancies. Here we show that IRF-1 expression attenuates gammaherpesvirus replication in primary macrophages, in part by increasing expression of cholesterol-25-hydroxylase (CH25H). CH25H and its product, 25-hydroxycholesterol, restrict replication of diverse virus families. Thus, our findings offer an insight into the mechanism by which IRF-1 attenuates replication of gammaherpesviruses, a mechanism that is likely to be applicable to other virus systems.

  • Identification of diverse alphacoronaviruses and genomic characterization of a novel SARS-like coronavirus from bats in China [PublishAheadOfPrint]

  • Although many severe acute respiratory syndrome-like coronaviruses (SARS-like CoVs) have been identified in bats in China, Europe and Africa, most have a genetic organization significantly distinct from human/civet SARS CoVs in the receptor-binding domain (RBD), which mediates receptor binding and determines the host spectrum, resulting in their failure to cause human infections and making them unlikely progenitors of human/civet SARS CoV. Here, a viral metagenomic analysis of 268 bat rectal swabs collected from four counties in Yunnan province has identified hundreds of sequences relating to alpha- and betacoronaviruses. Phylogenetic analysis based on a conserved region of the RNA-dependent RNA polymerase gene revealed that alphacoronaviruses had diversities with some obvious differences from those reported previously. Full genomic analysis of a new SARS-like CoV from Baoshan (LYRa11) showed that it was 29,805 nt in length with 13 open reading frames (ORFs), sharing 91% nt identity with human/civet SARS CoVs and the most recently reported SARS-like CoV Rs3367, while 89% with other bat SARS-like CoVs. Notably it showed highest sequence identity with the S gene of SARS CoVs and Rs3367, especially in the RBD region. Antigenic analysis showed that the S1 domain of LYRa11 could be efficiently recognized by SARS-convalescent human serum indicating that LYRa11 is a novel virus antigenically close to SARS CoV. Recombination analyses indicate that LYRa11 is likely a recombinant descended from parental lineages that had evolved into a number of bat SARS-like CoVs.

    IMPORTANCE Although many SARS-like coronaviruses (CoV) have been discovered in bats worldwide, there are significant different genic structure, particularly in S1 domain, which is responsible for host tropism determination, between bat SARS-like CoVs and human SARS CoVs, indicating that most reported bat SARS-like CoVs are not the progenitors of human SARS CoV. We have identified diverse alphacoronaviruses and a close relative (LYRa11) to SARS CoV in bats collected in Yunnan, China. Further analysis showed that alpha- and betacoronaviruses have different circulation and transmission dynamics in bat populations. Notably full genomic sequence and antigenic study demonstrated that LYRa11 is phylogenetically and antigenically closely related to SARS CoV. Recombination analyses indicate that LYRa11 is a recombinant from certain bat SARS-like CoVs circulating in Yunnan province.

  • Mixed Triple: allied viruses in unique isolates of recent highly virulent type 2 bovine viral diarrhea virus (BVDV-2) detected by deep sequencing [PublishAheadOfPrint]

  • In February 2013 very severe acute clinical symptoms were observed in calves, heifers, and dairy cattle in several farms in North Rhine Westphalia and Lower Saxony, Germany. Deep sequencing revealed the coexistence of three distinct genome variants within the recent highly virulent BVDV-2 isolates. While the major portion (ca. 95%) of the population harbored a duplication of a 222 nt segment within the p7/NS2 encoding region, the minority reflected the standard structure of a BVDV-2-genome. Additionally, unusual mutations were found in both variants within the highly conserved p7 and close to the p7/NS2 cleavage site. Using a reverse genetics system of a BVDV-2a strain with a similar duplication, it could be demonstrated that during replication genomes without duplication are generated de novo from genomes with duplication. The major variant with duplication is compulsorily escorted by the minor variant without duplication. RNA secondary structure prediction allowed the analysis of the unique, but stable mixture of three BVDV variants and also provided the explanation for their generation. Finally, our results suggest that the variant with duplication plays the major role for the highly virulent phenotype.

    Importance This study emphasizes the importance of full-genome deep sequencing in combination with manual in-depth data analysis for the investigation of viruses in basic research and diagnostics. Here, we investigated recent highly virulent bovine viral diarrhea virus isolates of a 2013 outbreak series. We discovered a unique special feature of the viral genome, an unstable duplication of 222 nucleotides, which is eventually deleted by viral polymerase activity leading to an unexpectedly mixed population of viral genomes in all investigated isolates. Our study is of high importance to the field since we demonstrate that these insertion/deletion events allow another level of genome plasticity of plus-strand RNA viruses beside the well-known polymerase-induced single nucleotide variations which are generally considered as the main basis for viral adaptation and evolution.

  • Transcription of the herpes simplex virus, type 1 genome during productive and quiescent infection of neuronal and non-neuronal cells. [PublishAheadOfPrint]

  • Herpes simplex virus, type 1 (HSV-1) can undergo a productive infection in non-neuronal and neuronal cells such that the genes of the virus are transcribed in an ordered cascade. HSV-1 can also establish a more quiescent or latent infection in peripheral neurons, where gene expression is substantially reduced relative to productive infection. HSV mutants defective in multiple immediate early (IE) gene functions are highly defective for later gene expression and model some aspects of latency in vivo. We compared the expression of wild-type (wt) virus and IE gene mutants in non-neuronal cells (MRC5) and adult murine trigeminal ganglion (TG) neurons using the Illumina platform for RNA sequencing (RNAseq). RNAseq analysis of wild type virus revealed that expression of the genome mostly followed the previously established kinetics, validating the method, while highlighting variations in gene expression within individual kinetic classes. The accumulation of immediate early transcripts differed between MRC5 cells and neurons, with a greater abundance in neurons. Analysis of a mutant defective in all five IE genes (d109) showed dysregulated genome wide low-level transcription that was more highly attenuated in MRC5 cells than in TG neurons. Furthermore, a subset of genes in d109 was more abundantly expressed over time in neurons. While the majority of the viral genome became relatively quiescent, the latency-associated transcript was specifically upregulated. Unexpectedly, other genes within repeat regions of the genome, as well as the unique genes just adjacent the repeat regions also remained relatively active in neurons. The relative permissiveness of TG neurons to viral gene expression near the joint region is likely significant during the establishment and reactivation of latency.

    IMPORTANCE During productive infection the genes of HSV-1 are transcribed in an ordered cascade. HSV can also establish a more quiescent or latent infection in peripheral neurons. HSV mutants defective in multiple immediate early (IE) genes establish a quiescent infection that models aspects of latency in vivo. We simultaneously quantified the expression of all the HSV genes in non-neuronal and neuronal cells by RNAseq analysis. The results for productive infection shed further light on the nature of genes and promoters of different kinetic classes. In quiescent infection, there was greater transcription across the genome in neurons relative to non-neuronal cells. In particular, the transcription of the latency-associated transcript (LAT), IE genes, and genes in the unique regions adjacent to the repeats, persisted in neurons. The relative activity of this region of the genome in the absence of viral activators suggests a more dynamic state for quiescent genomes persisting in neurons.

  • Electrostatic interactions drive the self-assembly and the transcription activity of the Pseudomonas phage {varphi}6 procapsid [PublishAheadOfPrint]

  • Assembly of an empty procapsid is a crucial step in the formation of many complex viruses. Here, we used the self-assembly system of the double-stranded RNA bacteriophage 6 to study the role of electrostatic interactions in a scaffolding-independent procapsid assembly pathway. We demonstrate that 6 procapsid assembly is sensitive to salt at both the nucleation and post-nucleation steps. Furthermore, we observed that the salt sensitivity of 6 procapsid-directed transcription is reversible.

  • A Conformation-Dependent Neutralizing Monoclonal Antibody Specifically Targeting Receptor-Binding Domain in MERS-CoV Spike Protein [PublishAheadOfPrint]

  • Prophylactic and therapeutic strategies are urgently needed to combat infections caused by the newly emerged Middle East respiratory syndrome coronavirus (MERS-CoV). Here we have developed a neutralizing monoclonal antibody (mAb), designated Mersmab1, which potently blocks MERS-CoV entry into human cells. Biochemical assays reveal that Mersmab1 specifically binds to the receptor-binding domain (RBD) of the MERS-CoV spike protein, and thereby competitively blocks the binding of the RBD to its cellular receptor dipeptidyl peptidase 4 (DPP4). Furthermore, alanine scanning of the RBD has identified several residues at the DPP4-binding surface that serve as neutralizing epitopes for Mersmab1. These results suggest that if humanized, Mersmab1 can potentially function as a therapeutic antibody for treating and preventing MERS-CoV infections. Additionally, Mersmab1 may facilitate studies on the conformation and antigenicity of MERS-CoV RBD and thus will guide rational design of MERS-CoV subunit vaccines.

    IMPORTANCE MERS coronavirus (MERS-CoV) is spreading in the human population and causing severe respiratory diseases with over 40% fatality. No vaccine is currently available to prevent MERS-CoV infections. Here, we have produced a neutralizing monoclonal antibody with the capacity to effectively block MERS-CoV entry into permissive human cells. If humanized, this antibody may be used as a prophylactic and therapeutic agent against MERS-CoV infections. Specifically, when given to a person (e.g., a patient's family member or a healthcare worker), either before or after exposure to MERS-CoV, the humanized antibody may prevent or inhibit MERS-CoV infection, thereby stopping the spread of MERS-CoV in humans. This antibody can also serve as a useful tool to guide the design of effective MERS-CoV vaccines.

  • A single amino acid mutation (I1012F) of the RNA polymerase of marine viral hemorrhagic septicemia virus changes the in vitro virulence to rainbow trout gill epithelial cells [PublishAheadOfPrint]

  • Viral hemorrhagic septicemia virus (VHSV) is separated into four different genotypes (I, II, III, and IV), with different sub-lineages (14, 16). European marine VHSV strains (of genotypes I, II, and III) are in general nonpathogenic or have very low pathogenicity to rainbow trout after waterborne challenge, and here we also show that genotype IVa is non-pathogenic to trout. Despite several attempts it has not been possible to link genomic variation to in vivo virulence. In vitro virulence to gill epithelial cells (GECs) has been used as a proxy for in vivo virulence and here we extend these studies further with the purpose to identify residues associated with in vitro virulence. Genotype Ia (DK-3592B) and genotype III (NO/650/07) isolates, pathogenic to rainbow trout (12), were compared to two marine strains nonpathogenic to trout, genotype Ib (strain 1p8 (24)) and genotype IVa (JF-09). DK-3592 and NO/650/07 were pathogenic to gill epithelial cells (GECs), while marine strains 1p8 and JF-09 were non-pathogenic to GECs. Eight conserved amino acid substitutions contrasting high and low virulent strains were identified and reverse genetics was used for a gain-of-virulence approach based on the JF-09 backbone. Mutations were introduced in the G, NV and L genes and 7 different virus clones were obtained. For the first time we show that a single amino acid mutation in a conserved region IV of the L protein, I1012F, rendered the virus able to replicate and induce cytopathic effect in trout GECs. The other six mutated variants remained nonpathogenic.

    IMPORTANCE This is the first study to clearly link in vitro virulence of VHSV with an amino acid residue in the L protein, a site located in a conserved region IV of the L protein. In vitro virulence is documented by induction of cytopathic effects and viability studies of GECs and the observed cellular responses to infection are associated with increased viral replication levels. There are no previous studies addressing the importance of the L protein or the RdRp for virus virulence, in vitro or in vivo. Therefore the findings reported here should broaden the search for pathogenicity traits in novirhabdoviruses and there is a possibility that the polymerase participates in defining host species virulence of various VHSV strains.

  • Conserved Neutralizing Epitope at Globular Head of Hemagglutinin in H3N2 Influenza Viruses [PublishAheadOfPrint]

  • Neutralizing antibodies that target the hemagglutinin of influenza virus either inhibit binding of hemagglutinin to cellular receptors or prevent the low-pH-induced conformational change in hemagglutinin required for membrane fusion. In general, the former type of antibody binds to the globular head formed by HA1 and has narrow strain specificity, while the latter type binds to the stem mainly formed by HA2 and has broad strain specificity. In the present study, we analyzed the epitope and function of a broadly neutralizing human antibody against H3N2 viruses, F005-126. The crystal structure of F005-126 Fab in complex with hemagglutinin revealed that the antibody binds to the globular head, spans a cleft formed by two hemagglutinin monomers in a hemagglutinin trimer, and cross-links them. It recognizes two peptide portions (sites L and R) and a glycan linked to asparagine at residue 285 using three complementarity-determining regions and framework 3 in the heavy chain. Binding of the antibody to sites L (residues 171-173, 239 and 240) and R (residues 91, 92, 270-273, 284 and 285) is mediated mainly by van der Waals contacts with the main chains of the peptides in these sites and secondarily by hydrogen bonds with a few side chains of conserved sequences in HA1. Furthermore, the glycan recognized by F005-126 is conserved among H3N2 viruses. F005-126 has the ability to prevent low-pH-induced conformational changes in hemagglutinin. The newly identified conserved epitope including the glycan should be immunogenic in humans, and may induce production of broadly neutralizing antibodies against H3 viruses.

    IMPORTANCE Antibodies play an important role in protection against influenza virus, and hemagglutinin is the major target for virus neutralizing Abs. It has long been believed that all effective neutralizing antibodies bind to the surrounding regions of the sialic acid-binding pocket and inhibit the binding of hemagglutinin to the cellular receptor. As mutations are readily introduced into such epitopes, this type of antibody shows narrow strain specificity. Recently, however, broadly neutralizing antibodies have been isolated. Most of these bind either to conserved sites in the stem region or to the sialic acid-binding pocket itself. In the present study, we identified a new neutralizing epitope in the head region recognized by a broadly neutralizing human antibody against H3N2. This epitope may be useful for design of vaccines.

  • The migration patterns of HCV in China were characterized for five major subtypes based on 411 volunteer blood donors sampled in 17 provinces/municipalities [PublishAheadOfPrint]

  • We investigated the migration patterns of HCV in China. Partial E1 and/or NS5B sequences were characterized from 411 volunteer blood donors sampled in 17 provinces/municipalities located in five larger regions: the North-Northeast, Northwest, Southwest, Central South, and Southeast. The sequences were classified into eight subtypes (1a=3, 1b=183, 2a=83, 3a=30, 3b=44, 6a=55, 6n=10, 6v=1) and a new subtype candidate. The BEAST analysis of the E1 sequences of the five major subtypes revealed distinct migration patterns. Subtype 1b showed four groups: one is prevalent nationwide with possible origins in the North-Northeast; two are locally epidemic in the Central South and Northwest, respectively, and have spread sporadically to other regions; the other one is likely linked to the long-distance dispersion among IDUs from the Northwest. Subtype 2a showed two groups: the larger one was mainly restricted to the Northwest and seemed to show a migration trend via the "Silk Road"; the smaller one, being geographically mixed, may represent descendants of those that spread widely during the contaminated plasma campaign in the 1990s. Subtype 3a exhibited three well-separated geographic groups that may be epidemically unrelated: one showed origins in the Northwest, one in the Southwest, and the other in the Central South. In contrast, subtype 3b represents a geographic mixture, suggesting migrations from the Southwest to the Northwest and sporadically to other regions. Structurally resembling 3a, the tree for 6a showed four groups that may indicate migrations from the Central South to Southeast, Southwest, and Northwest. Strikingly, no 6a was identified in the North-Northeast.

    IMPORTANCE With a population of greater than 1.3 billion and a territory of ggt;960 million square kilometers, China has a total of 34 provinces/municipalities. In such a vast country, the epidemic history and migration trends of HCV are thought to be unique and complex but variable among regions and are unlikely to be represented by those observed in only one or at best a few provinces/municipalities. However, due to the difficulties in recruiting patients, all previous studies for this purpose have only been based on data from limited regions and therefore, geographical biases were unavoidable. In this study such biases were greatly reduced because we utilized samples collected from volunteer blood donors in 17 provinces/municipalities. To our knowledge, this is the first study in which the HCV isolates represented such a large portion of the country and thus, the results should shed light on the current understanding of HCV molecular epidemiology.

  • Potential role for CA-SP in nucleating retroviral capsid maturation [PublishAheadOfPrint]

  • During virion maturation the Rous sarcoma virus (RSV) capsid protein is cleaved from the Gag protein as the proteolytic intermediate CA-SP. Further trimming at two C-terminal sites removes the spacer peptide (SP) producing the mature capsid proteins CA and CA-S. Abundant genetic and structural evidence shows that the SP plays a critical role in stabilizing hexameric Gag interactions that form and stabilize immature particles. Freeing CA-SP from Gag breaks immature interfaces and initiates formation of mature capsids. The transient persistence of CA-SP in maturing virions and identification of second-site mutations in SP that restore infectivity to maturation-defective mutant viruses led us to hypothesize that SP may play an important role in promoting assembly of mature capsids. This study presents a biophysical and biochemical characterization of CA-SP and its assembly behavior. Our results confirm previously published cryo-EM structures by Keller et al (2013) showing monomeric CA-SP is fully capable of assembling into capsid-like structures identical to those formed by CA. Further, SP confers aggressive assembly kinetics, suggestive of higher affinity CA-SP interactions than observed with either of the mature capsid proteins. The aggressive assembly observed with CA-SP is largely independent of the SP amino acid sequence, but formation of well-ordered particles is sensitive to the presence of the N-terminal bbeta;-hairpin. Additionally, CA-SP can nucleate assembly of CA and CA-S. These results suggest a model in which CA-SP, once separated from the Gag lattice, can actively promote the interactions that form mature capsids and provide a nucleation point for mature capsid assembly.

    Importance: The spacer peptide is a documented target for antiretroviral therapy. This study examines the biochemical and biophysical properties of CA-SP, an intermediate form of the retrovirus capsid protein. The results demonstrate a previously unrecognized activity of SP in promoting capsid assembly during maturation.

  • Viral and cellular FLIPs: a comparison of their roles in regulating intrinsic immune responses [PublishAheadOfPrint]

  • FLICE-inhibitory proteins (FLIPs) are a family of viral (poxvirus and herpesvirus) and cellular proteins. The hallmark of this family is the presence of tandem death-effector domains (DED). Despite this shared motif, each protein possesses different abilities to modulate apoptosis, NF-B and IRF3. These similarities and differences are discussed and highlighted here. The comparative study of FLIPs provides a unique basis to understand virus-host interactions, viral pathogenesis and cellular regulation of immune system signal transduction pathways.

  • HIV-1 PROTEASE SUBSTRATE CO-EVOLUTION IN NELFINAVIR RESISTANCE [PublishAheadOfPrint]

  • Resistance to various Human Immunodeficiency Virus-1 (HIV-1) protease inhibitors (PIs) challenges the effectiveness of therapies in treating HIV-1 infected individuals and AIDS patients. The virus accumulates mutations within the protease (PR) that render the PIs less potent. Occasionally, Gag sequences also co-evolve with mutations at PR cleavage sites contributing to drug resistance. In this study, we investigated the structural basis of co-evolution of p1-p6 cleavage site with the nelfinavir (NFV)-resistance D30N/N88D protease mutations by determining crystal structures of wild type and NFV-resistant HIV-1 protease in complex with p1-p6 substrate peptide variants with L449F and/or S451N. Alterations of residue 30's interaction with the substrate are compensated by the co-evolving L449F and S451N cleavage site mutations. This interdependency in the PRnndash;p1-p6 interactions enhances inter-molecular contacts and reinforces the overall fit of the substrate within the substrate envelope, likely enabling co-evolution to sustain substrate recognition and cleavage in the presence of PR resistance mutations.

    IMPORTANCE Resistance to Human Immunodeficiency Virus-1 (HIV-1) protease inhibitors challenges the effectiveness of therapies in treating HIV-1 infected individuals and AIDS patients. Mutations in HIV-1 protease selected under the pressure of protease inhibitors render the inhibitors less potent. Occasionally, Gag sequences also mutate and co-evolve with protease, contributing to maintenance of viral fitness and to drug resistance. In this study, we investigated the structural basis of co-evolution at the Gag p1-p6 cleavage site with the nelfinavir (NFV)-resistance D30N/N88D protease mutations. Our structural analysis reveals the interdependency of proteasenndash;substrate interactions, and how co-evolution may restore substrate recognition and cleavage in the presence of protease drug resistance mutations.

  • Neutrophil depletion suppresses pulmonary vascular hyperpermeability and occurrence of pulmonary edema caused by hantavirus infection in C.B-17 Scid mice. [PublishAheadOfPrint]

  • Hantavirus infections are characterized by vascular hyperpermeability and neutrophilia. However, the pathogenesis of this disease is poorly understood. Here, we demonstrate for the first time that pulmonary vascular permeability is increased by Hantaan virus infection and results in the development of pulmonary edema in C.B-17 severe combined immunodeficiency (SCID) mice lacking functional T cells and B cells. Increases in neutrophils in the lung and blood were observed when pulmonary edema began to be observed in the infected SCID mice. The occurrence of pulmonary edema was inhibited by neutrophil depletion. Moreover, the pulmonary vascular permeability was also significantly suppressed by neutrophil depletion in the infected mice. Taken together, the results suggest that neutrophils play an important role in pulmonary vascular hyperpermeability and occurrence of pulmonary edema after hantavirus infection in SCID mice.

    Importance: Although hantavirus infections are characterized by the occurrence of pulmonary edema, the pathogenic mechanism remains largely unknown. In this study, we demonstrated for the first time in vivo that hantavirus infection increases pulmonary vascular permeability and results in the development of pulmonary edema in SCID mice. This novel mouse model for human hantavirus infection will be a valuable tool and will contribute to elucidation of the pathogenetic mechanisms. Although the involvement of neutrophils in the pathogenesis of hantavirus infection has largely been ignored, the results of this study using the mouse model suggest that neutrophils are involved in the vascular hyperpermeability and development of pulmonary edema in hantavirus infection. Further study of the mechanisms could lead to the development of specific treatment for hantavirus infection.

  • Cullin 4A and Cullin4B are Interchangeable for HIV Vpr and Vpx Action Through the CRL4 Ubiquitin Ligase Complex [PublishAheadOfPrint]

  • The human immunodeficiency virus (HIV) seizes control of cellular cullin-RING E3 ubiquitin ligases (CRLs) to promote viral replication. HIV-1 Vpr and HIV-2/SIV Vpr and Vpx engage the cullin 4-containing ubiquitin ligase complex (CRL4) to cause polyubiquitination and proteasomal degradation of host proteins, including ones that block infection. HIV-1 Vpr engages CRL4 to trigger degradation of uracil-N-glycosylase 2 (UNG2). Both HIV-1 Vpr and HIV-2/SIV Vpr tap CRL4 to initiate G2 cell cycle arrest. HIV-2/SIV Vpx secures CRL4 to degrade the anti-viral protein SAMHD1. CRL4 includes either cullin 4A (CUL4A) or cullin 4B (CUL4B) among its components. Whether Vpr or Vpx rely on CUL4A, CUL4B, or both to act through CRL4 is not known. Reported structural, phenotypic, and intracellular distribution differences between the two CUL4 types led us to hypothesize that Vpr and Vpx would employ these in a function-specific manner. Here we determined CUL4 requirements for HIV-1 and HIV-2/SIV Vpr -mediated G2 cell cycle arrest, HIV-1 Vpr -mediated UNG2 degradation, and HIV-2 Vpx -mediated SAMHD1 degradation. Surprisingly, CUL4A and CUL4B are exchangeable for CRL4 dependent Vpr and Vpx action, except in primary macrophages where Vpx relies on both CUL4A and CUL4B for maximal SAMHD1 depletion. This work highlights the need to consider both CUL4 types for Vpr and Vpx functions and also shows that the intracellular distribution of CUL4A and CUL4B can vary by cell type.

    Importance The work presented here shows for the first time that HIV Vpr and Vpx do not rely exclusively on CUL4A to cause ubiquitination through the CRL4 ubiquitin ligase complex. Further, our finding that intracellular CUL4 and SAMHD1 distribution can vary with cell type provides the basis for reconciling previous disparate findings regarding the site of SAMHD1 depletion. Finally, our observations in primary immune cells provide insight into the cell biology of CUL4A and CUL4B that will help differentiate the functions of these similar proteins.

  • hnRNP L and NF90 interact with hepatitis C virus 5' terminal untranslated RNA and promote efficient replication [PublishAheadOfPrint]

  • The 5' terminal sequence of the hepatitis C virus (HCV) positive-strand RNA genome is essential for viral replication. Critical host factors, including a miR-122/Ago2 complex and poly(rC) binding protein 2 (PCBP2), associate with this RNA segment. We used a biotinylated RNA pull-down approach to isolate host factors binding to the HCV 5' terminal 47 nucleotides and, in addition to Ago2 and PCBP2, identified several novel proteins including IGF2BP1, hnRNP L, DHX9, ADAR1 and NF90 (ILF3). PCBP2, IGF2BP1 and hnRNP L bound single-stranded RNA, while DHX9, ADAR1 and NF90 bound a cognate double-stranded RNA bait. PCBP2, IGF2BP1 and hnRNP L binding were blocked by pre-annealing the ssRNA bait with miR-122, indicating that they bind the RNA in competition with miR-122. However, IGF2BP1 binding was also inhibited by high concentrations of heparin, suggesting that it bound the bait nonspecifically. Among these proteins, siRNA-mediated depletion of hnRNP L and NF90 significantly impaired viral replication and reduced infectious virus yields without substantially affecting HCV IRES-mediated translation. hnRNP L and NF90 were found to associate with HCV RNA in infected cells, and to co-immunoprecipate with NS5A in an RNA-dependent manner. Both also associate with detergent-resistant membranes where viral replication complexes reside. We conclude that hnRNP and NF90 are important host factors for HCV replication, at least in cultured cells, and may be present in the replication complex.

    IMPORTANCE Although HCV replication has been intensively studied in many laboratories, many aspects of the viral life cycle remain obscure. Here, we use a novel RNA pull-down strategy coupled with mass spectrometry to identify host cell proteins that interact functionally with regulatory RNA elements located at the extreme 5' end of the positive-strand RNA genome. We identify two, primarily nuclear RNA-binding proteins, hnRNP L and HF90, with previously unrecognized pro-viral roles in HCV replication. The data presented add to current understanding of the replication cycle of this pathogenic human virus.

  • Enhanced immunogenicity of a HIV-1 DNA vaccine delivered with electroporation via combined intramuscular and intradermal routes. [PublishAheadOfPrint]

  • It is accepted that an effective prophylactic HIV-1 vaccine is likely to have the greatest impact on viral transmission rates. As previous reports have implicated DNA-prime, protein-boost regimes to be efficient activators of humoral responses, we sought to optimise this regime to further augment vaccine immunogenicity. Here we evaluated single verses concurrent intradermal (ID) and intramuscular (IM) vaccination as a DNA-priming strategy for their abilities to elicit humoral and cellular responses against a model HIV-1 vaccine antigen, CN54gp140. To further augment vaccine-elicited T and B cell responses, we enhanced cellular transfection with electroporation and then boosted the DNA-primed responses with Subcutaneous (SC), Intranasal (IN), Intramuscular (IM) or Transcutaneous (TC) homologous protein. In mice, the concurrent priming regime resulted in significantly elevated IFN- T cell and high avidity antigen-specific IgG B cell responses, a hallmark of B cell maturation. Protein-boosting of the concurrent DNA strategy further enhanced IgG concentrations but had little impact on T cell reactivity. Interestingly protein-boosting by the subcutaneous route increased antibody avidity to a greater extent than either IM, IN or TC administration, suggesting this route may be preferential for driving B cell maturation. Using an alternative and larger animal model, the rabbit, we found the concurrent DNA-priming strategy followed by SC protein-boosting to again be capable of eliciting high avidity humoral responses and able to also neutralize HIV-1 pseudoviruses from diverse clades (A, B and C). Taken together we show that concurrent multiple-route DNA vaccinations induce strong cellular immunity in addition to potent and high avidity humoral immune responses.

    Importance: The route of vaccination has profound effects on prevailing immune responses. Due to the insufficient immunogenicity and protection of current DNA delivery strategies, we evaluated concurrent DNA delivery via simultaneous administration of plasmid DNA by the IM and ID route. The rationale behind this paper was to provide clear evidence to the utility of concurrent vaccinations for an up and coming human clinical trial. Furthermore this work will guide future preclinical studies by evaluating the use of model antigens and plasmids for prime-boost strategies. This paper will not only be of interest to virologists and vaccinologists working in the HIV field but also for researchers working in other viral vaccine settings and critically to the wider field of vaccine delivery.

  • Alternative Recognition of the Conserved Stem-Epitope in Influenza A Hemagglutinin by a VH3-30-Encoded Heterosubtypic Antibody. [PublishAheadOfPrint]

  • A human monoclonal heterosubtypic antibody, mAb 3.1, with its heavy chain encoded by VH3-30, was isolated using phage display with immobilized hemagglutinin from A/Japan/305/1957(H2N2) as the target. Antibody 3.1 potently neutralizes influenza viruses from the H1a clade (i.e. H1, H2, H5, H6), but has little neutralizing activity against the H1b clade. Its crystal structure in complex with HA from a pandemic H1N1 influenza virus A/South Carolina/1/18(H1N1) revealed that, like other heterosubtypic anti-influenza antibodies, mAb3.1 contacts a hydrophobic groove in the HA stem, primarily using its heavy chain. However, in contrast to the closely related mAb FI6 that relies heavily on HCDR3 for binding, mAb 3.1 utilizes residues from HCDR1, HCDR3 and FR3. Interestingly, HCDR1 of mAb 3.1 adopts anaalpha;-helical conformation and engages in very similar hydrophobic interactions with the HA as the de novo in silico designed and affinity matured synthetic protein HB36.3. These findings improved our understanding of the molecular requirements for binding to the conserved epitope in the stem of the HA protein and, therefore, aid the development of more universal influenza vaccines targeting these epitopes.

    Importance Influenza viruses rapidly evade pre-existing immunity by constantly altering the immunodominant neutralizing antibody epitopes (antigenic drift), or by acquiring new envelope serotypes (antigenic shift). As a consequence, the majority of antibodies elicited by immunization or infection only protect against the immunizing or closely related strains. Here, we describe a novel monoclonal antibody recognizing the conserved heterosubtypic epitope in the stem of influenza A virus hemagglutinin. This antibody, referred to as mAb 3.1, recognizes its epitope in a manner that resembles recognition of a similar epitope by the de novo in silico designed and affinity matured synthetic protein HB36.3. Thus, besides providing novel insights into the molecular interactions between heterosubtypic antibodies and influenza virus hemagglutinin, mAb 3.1 demonstrates that de novo in silico designed and affinity matured synthetic proteins can foretell naturally selected antibody binding. This knowledge will aid development of a pan-influenza vaccine.

  • Development of a high yield live attenuated H7N9 influenza vaccine that provides protection against homologous and heterologous H7 wild-type viruses in ferrets [PublishAheadOfPrint]

  • Live attenuated H7N9 influenza vaccine viruses that possess the hemagglutinin (HA) and neuraminidase (NA) gene segments from the newly emerged wild-type (wt) A/Anhui/1/2013 (H7N9) and six internal protein gene segments from the cold-adapted influenza virus A/Ann Arbor/6/60 (AA ca) were generated by reverse genetics. The reassortant virus containing the original wt A/Anhui/1/2013 HA and NA sequences replicated poorly in eggs. Multiple variants with amino acid substitutions in the HA head domain that improved viral growth were identified by viral passage in eggs and MDCK cells. The selected vaccine virus containing two amino acid changes (N133D/G198E) in the HA improved viral titer by more than 10-fold (reached a titer of 108.6 Fluorescent Focus Units/mL) without affecting viral antigenicity. Introduction of these amino acid changes into an H7N9 PR8 reassortant also significantly improved viral titers and HA protein yield in eggs. The H7N9 ca vaccine virus was immunogenic in ferrets. A single dose of vaccine conferred complete protection of ferrets from homologous wt A/Anhui/1/2013 (H7N9) and near complete protection from heterologous wt A/Netherlands/219/2013 (H7N7) challenge infection. Therefore, this H7N9 LAIV candidate has been selected for vaccine manufacture and clinical evaluation to protect humans from wt H7N9 virus infection.

    IMPORTANCE In response to the recent avian H7N9 influenza virus infection in humans, we developed a live attenuated H7N9 influenza vaccine (LAIV) with two amino acid substitutions in the viral HA protein that improved vaccine yield by 10-fold in chicken embryonated eggs, the substrate for vaccine manufacture. The two amino acids also improved the antigen yield for inactivated H7N9 vaccines, demonstrating that this finding could great facilitate the efficiency of H7N9 vaccine manufacture. The candidate H7N9 LAIV was immunogenic and protected ferrets against homologous and heterologous wild-type H7 virus challenge, making it suitable for use in protecting humans from H7 infection.

  • Pathogenic Features Associated with Increased Virulence upon Simian Immunodeficiency Virus Cross-Species Transmission from Natural Hosts [PublishAheadOfPrint]

  • While SIVs are generally nonpathogenic in their natural hosts, dramatic increases in pathogenicity may occur upon cross-species transmission to new hosts. Deciphering the drivers of these increases in virulence is of major interest for understanding the emergence of new HIVs. We transmitted SIVsab from the sabaeus species of African green monkeys (AGMs) to pigtailed macaques (PTMs). High acute viral replication occurred in all SIVsab-infected PTMs, yet the outcome of chronic infection was highly variable, ranging from rapid progression to controlled infection, which was independent of the dynamics of acute viral replication, CD4+ T cell depletion, or preinfection levels of microbial translocation. Infection of seven PTMs with plasma collected at necropsy from a rapid progressor PTM was consistently highly pathogenic, with high acute and chronic viral replication, massive depletion of memory CD4+ T cells and disease progression in all PTMs. Plasma inoculum used for the serial passage did not contain adventitious bacterial or viral contaminants. Single genome amplification showed that this inoculum was significantly more homogenous than the inoculum directly derived from AGMs, pointing to a strain selection in PTMs. In spite of similar peak plasma viral loads between the monkeys in the two passages, immune activation/inflammation levels dramatically increased in PTMs infected with the passaged virus. These results suggest that strain selection and a massive cytokine storm are major factors behind increased pathogenicity of SIV upon serial passage and adaptation of SIVs to new hosts following cross-species transmission.

    Importance: We report here that upon cross species transmission and serial passage of SIVsab from its natural host, the sabaeus African green monkey (AGM), to a new pigtailed macaque (PTM) host, viral adaptation and increased pathogenicity involves strain selection and a massive cytokine storm. These results permit the design of strategies aimed at preventing cross-species transmission from natural hosts of SIVs to humans in endemic areas. Furthermore, our study describes a new animal model for SIV infection. As the outcome of SIVsab infection in PTMs, African green monkeys, and rhesus macaques is different, the use of these systems enable comparative studies between pathogenic, nonpathogenic and elite-controlled infections, to gain insight into the mechanisms of SIV immunodeficiency and comorbidities.

  • The stress granule component TIA-1 binds Tick-borne Encephalitis Virus RNA and is Recruited to Perinuclear Sites of Viral Replication to inhibit viral translation [PublishAheadOfPrint]

  • Flaviviruses are a major cause of disease in humans and animals worldwide. Tick-borne encephalitis virus (TBEV) is the most important arthropod-borne flavivirus endemic in Europe and is the etiological agent of tick-borne encephalitis, a potentially fatal infection of the central nervous system. However, the contribution of host proteins during TBEV infection is poorly understood. In this work we investigate the cellular protein TIA-1 and its cognate factor TIAR, which are stress-induced RNA-binding proteins involved in the repression of initiation of translation of cellular mRNAs and in the formation of stress granules. We show that TIA-1 and TIAR interact with viral RNA in TBEV infected cells. During TBEV infection, cytoplasmic TIA-1 and TIAR are recruited at sites of viral replication with concomitant depletion from stress granules. This effect is specific since G3BP1, another component of these cytoplasmic structures, remains localized to stress granules. Moreover, heat-shock induction of stress granules containing TIA-1, but not G3BP1, is inhibited in TBEV infected cells. Infection of cells depleted for TIA-1 or TIAR by siRNA, or TIA-1-/- mouse fibroblasts, leads to a significant increase of TBEV extracellular infectivity. Interestingly, TIAR-/- fibroblasts show the opposite effect on TBEV infection and this phenotype appears related to an excess of TIA-1 in these cells. Taking advantage of a TBE-luciferase replicon system we also observe increased luciferase activity in TIA-1-/- mouse fibroblasts at early time points consistent with TIA-1 mediated inhibition at the level of the first round of viral translation. These results indicate that in response to TBEV infection, TIA-1 is recruited to sites of virus replication to bind TBEV RNA and modulate viral translation independently of SG formation.

    Significance bbull; Extends previous work that demonstrated TIA-1/TIAR recruitment at sites of Flavivirus replication;

    bbull; Demonstrates that TIAR behaves like TIA-1 as an inhibitor of viral replication using a RNAi approach in human cells that contradicts the previous hypothesis based on MEF knockouts only;

    bbull; Demonstrates that TBEV is capable of inducing bona fide stress granules G3BP1/eIF3/eIF4B positive;

    bbull; Demonstrates a differential phenotype of stress-response proteins following viral infection; bbull; Implicates TIA-1 in viral translation and as a modulator of TBEV replication.

  • Primary human macrophages serve as vehicles for vaccinia virus replication and dissemination [PublishAheadOfPrint]

  • Human monocytic and professional antigen-presenting cells (APCs) have so far only been reported to exhibit abortive infections with vaccinia virus (VACV). We found that monocyte-derived macrophages (MDMs) including granulocyte macrophage colony-stimulating factor (GM-CSF)-polarized M1 and macrophage colony-stimulating factor (M-CSF)-polarized M2, but not human AB serum-derived cells, were permissive to VACV replication. The titers of infectious virions in both cell-free supernatants and cellular lysates of infected M1 and M2 markedly increased in a time-dependent manner. The majority of virions produced in permissive MDMs were extracellular enveloped virions (EEV), a secreted form of VACV associated with long-range virus dissemination, and were mainly found in the culture supernatant. Infected MDMs formed VACV factories, actin tails, virion-associated branching structures and cell linkages, indicating that MDMs are able to initiate de novo synthesis of viral DNA and promote virus release. VACV replication was sensitive to inhibitors against the Akt and Erk1/2 pathways that can be activated by VACV infection and M-CSF stimulation. Classical activation of MDMs by LPS + IFN- stimulation caused no effect on VACV replication, while alternative activation of MDMs by IL-10 or LPS + IL-1bbeta; treatment significantly decreased VACV production. The IL-10-mediated suppression of VACV replication was largely due to Stat3 activation as a Stat3 inhibitor restored virus production to levels observed without IL-10 stimulation. In conclusion, our data demonstrate that primary human macrophages are permissive to VACV replication. After infection, these cells produce EEV for long-range dissemination and also form structures associated with virions, which may contribute to cell-cell spread.

    Importance Our results provide critical information to the burgeoning fields of cancer-killing (oncolytic) virus therapy with vaccinia virus (VACV). One type of macrophages (M2) is considered a common presence in tumors and is associated with poor prognosis. Our results demonstrate a preference for VACV replication in M2 macrophages, and could assist in designing treatments and engineering poxviruses with special considerations for their effect on M2 macrophage-containing tumors. Additionally, this work highlights the importance of macrophages in the field of vaccine development using poxviruses as vectors. The understanding of the dynamics of poxvirus-infected foci is central in understanding the effectiveness of the immune response to poxvirus-mediated vaccine vectors. Monocytic cells have been found to be an important part of VACV skin lesions in mice in controlling the infection as well as mediating virus transport out of infected foci.

  • Epstein-Barr Virus infection induces indoleamine 2,3-dioxygenase expression in human monocyte-derived macrophages through p38/MAPK and NF-{kappa}B pathways: impairment in T cell functions [PublishAheadOfPrint]

  • EBV infection has been observed in tumor infiltrated macrophages, but its infection effects on the macrophage immune functions remain are poorly understood. Here, we showed that some macrophages in the tumor stroma of nasopharyngeal carcinoma (NPC) tissue expressed the immunosuppressive protein IDO stronger than tumor cells. EBV infection induced the mRNA, protein and enzymatic activity of IDO in human monocyte-derived macrophages (MDMs). The infection increased the production of TNF-aalpha; and IL-6, whereas the neutralizing antibodies against TNF-aalpha; and IL-6 inhibited IDO induction. EBV infection also activated the MAPK p38 and NF-B, and the inhibitors of these two pathways with SB202190 and SN50 almost abrogated TNF-aalpha;, IL-6 production and inhibited IDO production. Moreover, the activation of IDO in response to EBV infection of MDMs suppressed the proliferation of T cells and impaired the cytotoxic activity of CD8+ T cells, whereas inhibition of IDO activity with 1-methyl-L-tryptophan (1-MT) did not affect T cell proliferation and function. These findings indicate that EBV-induced IDO expression in MDMs is substantially mediated by IL-6- and TNF-aalpha;-dependent mechanisms via the p38/MAPK and NF-B pathways, suggesting a possible role of EBV-mediated IDO expression in tumor stroma of NPC may create a microenvironment of suppressed T cell immune responses.

    IMPORTANT CD8+ cytotoxic T cells (CTL) play an important role in the control of viral infections and destroy tumor cells. Activation of the tryptophan catabolizing enzyme indoleamine 2,3-dioxygenase (IDO) in cancer tissues facilitates immune escape by impairment of CTL cell functions. IDO expression was observed in some macrophages of the tumor stroma of nasopharyngeal carcinoma (NPC) tissue, and IDO could be induced in Epsteinnndash;Barr virus (EBV) infected human monocyte-derived tomacrophages (MDMs). NPC cells and macrophages have been found to produce IDO in an IFN--dependent manner. Instead, EBV-induced IDO expression in MDMs is substantially mediated by IL-6- and TNF-aalpha;-dependent mechanisms via the p38/MAPK and NF-B pathways, which suppressed the proliferation of T cells and impaired the cytotoxic activity of CD8+ T cells. This finding provides a new interpretation for the mechanism of immune escape of EBV, and showed the immunosuppressed role of EBV-mediated IDO expression in tumor stroma of NPC.

  • A broadly neutralizing human monoclonal antibody directed against a novel conserved epitope on the influenza virus H3 hemagglutinin globular head [PublishAheadOfPrint]

  • Most neutralizing antibodies elicited during influenza infection or vaccination target immunodominant, variable epitopes on the globular head region of hemagglutinin (HA), which leads to narrow strain protection. In this study, we describe the properties of a unique anti-HA monoclonal antibody, D1-8, that was derived from human B-cells and exhibits potent, broad neutralizing activity across antigenically diverse influenza H3 subtype viruses. Based on selection of escape variants, we show that D1-8 targets a novel epitope on the globular head region of the influenza HA protein. The HA residues implicated in D1-8 binding are highly conserved among H3N2 viruses, and are located proximal to antigenic site D, We demonstrate that the potent in vitro antiviral activity of D1-8 translates into protective activity in mouse models of influenza infection. Furthermore, D1-8 exhibits superior therapeutic survival benefit in influenza infected mice compared to the neuraminidase inhibitor, oseltamivir, when treatment is started late in infection. The present study suggests the potential application of this monoclonal antibody for the therapeutic treatment of H3N2 influenza infection.

    Importance Recently a few globular head targeting mAbs have been discovered that exhibit activity against different subtypes of influenza subtypes, such as H1; however, none of the previously described mAbs showed broadly neutralizing activity against diverse H3 viruses. In this study, we describe a human mAb, D1-8, that exhibits potent, broad neutralizing activity against antigenically diverse H3 subtype viruses. The genotypic analysis of escape mutants revealed a unique putative epitope region in the globular head of H3 HA that is comprised of highly conserved residues and is distinct from the receptor binding site. Furthermore, we demonstrate that D1-8 exhibits superior therapeutic efficacy in influenza infected mice compared to the neuraminidase inhibitor, oseltamivir, when treatment is started late in infection. In addition to describing a novel anti-globular head of H3 HA mAb with potent broadly neutralizing activity, our study suggests the potential of D1-8 for therapeutic treatment of seasonal influenza H3 infection.

  • Murine gammaherpesvirus 68 encoding open reading frame 11 targets TANK binding kinase 1 to negatively regulate the host type I interferon response [PublishAheadOfPrint]

  • Upon viral infection, type I interferons such as interferon -aalpha; (IFN-aalpha;) and -bbeta; (IFN-bbeta;) are rapidly induced and activate multiple antiviral genes, thereby serving as the first line of host defense. Many DNA and RNA viruses counteract the host interferon system by modulating the production of IFNs. In this study, we report that murine gammaherpesvirus 68 (MHV-68), a double strand DNA virus, encodes open reading frame 11 (ORF11), a novel immune modulator to block IFN-bbeta; production. ORF11-deficient recombinant viruses induced more IFN-bbeta; production in fibroblast and macrophage cells than MHV-68 WT or a marker rescue. MHV-68 ORF11 decreased IFN-bbeta; promoter activation by various factors, the signaling of which converges onto TBK1-IRF3 activation. MHV-68 ORF11 directly interacted with both overexpressed and endogenous TBK1, but not with IRF3. Physical interactions between ORF11 and endogenous TBK1 were further confirmed during virus replication in fibroblasts using a recombinant virus expressing FLAG-ORF11. ORF11 efficiently reduced interaction between TBK1 and IRF3 and further inhibited activation of IRF3, thereby negatively regulating IFN-bbeta; production. Our domain mapping study showed that the central domain of ORF11 was responsible for both TBK1 binding and inhibition of IFN-bbeta; induction, while the kinase domain of TBK1 was sufficient for ORF11 binding. Taken together, these results suggest a mechanism underlying inhibition of IFN-bbeta; production by a gammaherpesvirus and highlight the importance of TBK1 in DNA virus replication.

    Importance Gammaherpesviruses are important human pathogens as they are associated with various kinds of tumors. Upon virus infection, the type I interferon pathway is activated by a series of signaling molecules and stimulates antiviral gene expressions. To subvert such interferon antiviral response, viruses are equipped with multiple factors that can inhibit its critical steps. In this study, we took an unbiased genomic approach using a mutant library of murine gammaherpesvirus 68 to screen a novel viral immune modulator that negatively regulates the type I interferon pathway and identified ORF11 as a strong candidate. ORF11 deficient virus infection produced more interferon than wild-type in both fibroblasts and macrophages. During virus replication, ORF11 directly bound to TBK1, a key regulatory protein in the interferon pathway and inhibited TBK1-mediated interferon production. Our results highlight a crucial role of TBK1 in controlling DNA virus infection and a viral strategy to curtail host surveillance.

  • Neurovirulence and Immunogenicity of Attenuated Recombinant Vesicular Stomatitis Viruses in Non-Human Primates [PublishAheadOfPrint]

  • In previous work, a prototypic recombinant vesicular stomatitis virus Indiana serotype (rVSIV) vector expressing SIV gag and HIV-1 env antigens protected non-human primates (NHPs) from disease following challenge with a HIV-1/SIV recombinant (SHIV). However, when tested in a stringent NHP neurovirulence (NV) model this vector was not adequately attenuated for clinical evaluation. For the work described here, the prototypic rVSIV vector was attenuated by combining specific G protein truncations with either N gene translocations or mutations (M33A and M51A) that ablate expression of sub-genic M polypeptides; by incorporation of temperature-sensitive mutations in the N and L genes and by deletion of the VSIV G gene to generate a replicon that is dependent on trans expression of G protein for in vitro propagation. When evaluated in a series of NHP NV studies, these attenuated rVSIV variants caused no clinical disease and demonstrated a very significant reduction in neuropathology compared to wild type VSIV and the prototypic rVSIVvaccine vector. In spite of greatly increased in vivo attenuation, some of the rVSIV vectors elicited cell mediated immune responses that were similar in magnitude to those induced by the much more virulent prototypic vector. These data demonstrate novel approaches to the rational attenuation of VSIV NV while retaining vector immunogenicity, and have led to identification of an rVSIV N4CT1gag1 vaccine vector that has now successfully completed Phase I clinical evaluation.

    IMPORTANCE The work described in this manuscript demonstrates a rational approach to the attenuation of vesicular stomatitis virus neurovirulence. The major attenuation strategy described here will be most likely applicable to other members of the Rhabdoviridae and possibly other families of non-segmented negative strand RNA viruses. These studies have also enabled the identification of an attenuated, replication competent rVSIV vector that has successfully undergone first in man clinical evaluation. Therefore, these studies represent a major milestone in the development of attenuated rVSIV, and likely other vesiculoviruses, as new vaccine platform(s) for use in humans.

  • CCR2 Deficiency Promotes Exacerbated Chronic Erosive Neutrophil-Dominated Chikungunya Virus Arthritis [PublishAheadOfPrint]

  • Chikungunya virus (CHIKV) is a member of a globally distributed group of arthritogenic alphaviruses, that cause weeks to months of debilitating polyarthritis/arthralgia, which is often poorly managed with current treatments. The arthritic disease is usually characterised by high levels of the chemokine CCL2 and a prodigious monocyte/macrophage infiltrate. Several inhibitors of CCL2 and its receptor CCR2 are in development and may find application for treating certain inflammatory conditions, including autoimmune and viral arthritides. Herein we used CCR2-/- mice to determine the effect of CCR2 deficiency on CHIKV infection and arthritis. Although there were no significant changes in viral load or RNA persistence, and only marginal changes in anti-viral immunity, arthritic disease was substantially increased and prolonged in CCR2-/- mice when compared with wild-type mice. The monocyte/macrophage infiltrate was replaced in CCR2-/- mice by a severe neutrophil (followed by an eosinophil) infiltrate, and was associated with changes in expression of multiple inflammatory mediators (including CXCL1, CXCL2, G-CSF, IL-1bbeta;, IL-10). Loss of anti-inflammatory macrophages and their activities (eg efferocytosis) was also implicated in the exacerbated inflammation. Clear evidence of cartilage damage was also seen in CHIKV infected CCR2-/- mice, a feature not normally associated with alphaviral arthritides. Although recruitment of CCR2+ monocyte/macrophages can contribute to inflammation, they also appear to be critical for preventing excessive pathology and resolving inflammation following alphavirus infection. Caution might thus be warranted when considering therapeutic targeting of CCR2/CCL2 for the treatment of alphaviral arthritides.

    Importance statement Herein we describe the first analysis of a viral arthritis in mice deficient for chemokine receptor CCR2. CCR2 is thought to be central to the monocyte/macrophage dominated inflammatory arthritic infiltrates seen after infection with arthritogenic alphaviruses, such as chikungunya virus. Surprisingly, the viral arthritis caused by chikungunya virus in CCR2 deficient mice was more severe, prolonged and erosive, and neutrophil dominated, with viral replication and persistence not significantly affected. Monocytes/macrophages recruited by CCL2 thus also appear to be important for both preventing even worse pathology mediated by neutrophils, and for promoting resolution of inflammation. Caution might thus be warranted when considering use of therapeutic agents that target CCR2/CCL2 or inflammatory monocyte/macrophages for treating alphaviral (and perhaps other viral) arthritides. Individuals with diminished CCR2 responses (due to drug treatment or other reasons) may also be at risk of exacerbated arthritic disease following an alphaviral infection.

  • HPV16 E6* induces oxidative stress and DNA damage [PublishAheadOfPrint]

  • High risk types of Human Papillomavirus (HPV) are the causative agents of virtually all cases of cervical cancer and a significant proportion of other anogenital cancers, as well as both oral and pharyngeal cancers. The high-risk types encode two viral oncogenes, E6 and E7, which work together to initiate cell transformation. Multiple steps, involving the activities and interactions of both viral and cellular proteins, are involved in the progression from HPV infection to cell transformation to cancer. The E6 oncoprotein is expressed as several isoforms, a full-length variant referred to as E6 and a few shorter isoforms collectively referred to as E6*. In this study, we found that expression of E6* increased the level of reactive oxygen species (ROS) in both HPV+ and HPV- cells. This increased oxidative stress led to higher levels of DNA damage, as assessed by the comet assay, quantification of 8-oxo-G, and PARP expression. The observed increase in ROS may be due to a decrease in cellular anti-oxidant activity, as we found that E6* expression also led to decreased expression of SOD2 and Gpx. These studies indicate that E6* may play an important role in virus-induced mutagenesis by increasing oxidative stress and DNA damage.

    Importance Our findings demonstrate for the first time that an HPV viral gene product, E6*, can increase ROS levels in host cells. This ability may play a significant role in both the viral life cycle and in cancer development, because an increase in oxidative DNA damage may facilitate both HPV genome amplification and increase the probability of HPV 16 DNA integration. Integration, in turn, is thought to be an important step in HPV-mediated carcinogenesis.

  • Restoration of MAGI-1 Expression in HPV Positive Tumour Cells Induces Cell Growth Arrest and Apoptosis. [PublishAheadOfPrint]

  • The cancer-causing high-risk HPV E6 oncoproteins target a number of cellular proteins that contain PDZ domains. However the role of many of these interactions in either the HPV life-cycle or in HPV-induced malignancy remains to be defined. Previous studies had shown that MAGI-1 was one of the most strongly bound PDZ domain-containing substrates of E6, and one consequence of this interaction appeared to facilitate the perturbation of tight junctions (TJs) by E6. In this study we describe the generation of a mutation, K499E, within the MAGI-1 PDZ1 domain, which is resistant to E6 targeting. This mutant allows restoration of MAGI-1 expression in HPV-positive cells, and defines additional activities of MAGI-1 that are overcome as a consequence of the association with E6. The re-expression of MAGI-1 in HPV-positive cells results in an increased recruitment of ZO-1 and PAR3 to sites of cell-cell contact, repression of cell proliferation, and induction of apoptosis. Whilst the K499E mutation does not significantly affect these intrinsic activities of MAGI-1 in HPV-negative cells, its resistance to E6 targeting in a HPV-positive setting results in more cells expressing the mutant MAGI-1 than the wild type MAGI-1, with a corresponding increase in TJ assembly, induction of apoptosis and reduction in cell proliferation. These studies provide compelling evidence of a direct role for the perturbation of MAGI-1 function by E6 in the HPV life-cycle and in HPV-induced malignancy.

    Importance It is clear that the targeting of PDZ-containing substrates by E6 is important for the normal viral life cycle and for the progression to malignancy. Nevertheless, which of these PDZ domain-containing proteins is relevant for HPV pathology is still elusive. In a previous study we provided the evidence that MAGI-1 is a sensitive proteolytic substrate for both the HPV-16 and HPV-18 E6 oncoproteins; however, the biological consequences associated with loss of MAGI-1 expression in HPV-positive cervical cancer cells are still poorly understood. Using a mutant MAGI-1, resistant to E6-mediated degradation, we show that its expression in cervical cancer cells promotes membrane recruitment of the tight junction-associated proteins ZO-1 and PAR3, represses cell proliferation and promotes apoptosis. These findings suggest that E6-mediated inhibition of MAGI-1 function contributes to HPV pathology by perturbing tight junction assembly with concomitant stimulation of proliferation and inhibition of apoptosis.

  • Two membrane-associated regions within the Nodamura virus RNA-dependent RNA polymerase are critical for both mitochondrial localization and RNA replication [PublishAheadOfPrint]

  • Viruses with positive strand RNA genomes amplify their genomes in replication complexes associated with cellular membranes. Little is known about the mechanism of replication complex formation in cells infected with Nodamura virus. This virus is unique in its ability to lethally infect both mammals and insects. In mice and in larvae of the greater wax moth (Galleria mellonella), Nodamura virus-infected muscle cells exhibit mitochondrial aggregation and membrane rearrangement, leading to disorganization of the muscle fibrils on the tissue level and ultimately in hind limb/segment paralysis. However, the molecular basis for this pathogenesis and the role of mitochondria in Nodamura virus infection remains unclear. Here we test the hypothesis that Nodamura virus establishes RNA replication complexes that associate with mitochondria in mammalian cells. Our results show that Nodamura virus replication complexes were targeted to mitochondria, as evidenced by biochemical, molecular, and confocal microscopy studies. More specifically, we show that the Nodamura virus RNA-dependent RNA polymerase interacted with the outer mitochondrial membranes as an integral membrane protein, and ultimately became associated with functional replication complexes. These studies will help us to understand the mechanism of replication complex formation and the pathogenesis of Nodamura virus for mammals.

    IMPORTANCE This study will further our understanding of Nodamura virus (NoV) genome replication and its pathogenesis for mice. NoV is unique among the Nodaviridae in its ability to infect mammals. Here we show that NoV establishes RNA replication complexes (RC's) in association with mitochondria in mammalian cells. These RC's contain newly synthesized viral RNA and feature physical interaction between mitochondrial membranes and the viral RdRp, mediated by two membrane-associated regions. While the nature of the interaction remains to be explored further, it appears to occur by a mode distinct from that described for the insect nodavirus Flock House virus (FHV). The interaction of the NoV RdRp with mitochondrial membranes is essential for clustering of mitochondria into networks that resemble those described for infected mouse muscle, associated with fatal hind-limb paralysis. This work therefore provides the first link between NoV RNA replication complex formation and the pathogenesis of this virus for mice.

  • Airborne Transmission of Highly Pathogenic H7N1 Influenza in Ferrets [PublishAheadOfPrint]

  • Avian H7 influenza viruses are recognized as potential pandemic viruses as personnel often become infected during poultry outbreaks. H7 infections in humans typically cause mild conjunctivitis; however, the H7N9 outbreak in the spring of 2013 has resulted in severe respiratory disease. To date, no H7 viruses have acquired the ability for sustained transmission in humans. Airborne transmission is considered a requirement for the emergence of pandemic influenza, and advanced knowledge of the molecular changes or signature required for transmission would allow early identification of pandemic vaccine seed stocks, screening and stockpiling of antiviral compounds, and focused eradication efforts on flocks harboring threatening viruses. Thus, we sought to determine if a highly pathogenic influenza A H7N1 (A/H7N1) virus, with no previous history of human infection, could become airborne transmissible in ferrets. We show that after 10 serial passages, A/H7N1 developed the ability to transmit to co-housed and airborne contact ferrets. Four amino acid mutations (PB2 T81I, NP V284M, M1 R95K, and Q211K) in the internal genes and a minimal amino acid mutation (K/R313R) in the stalk region of the HA protein were associated with airborne transmission. Furthermore, transmission was not associated with a loss of virulence. These findings highlight the importance of the internal genes in host adaptation and suggest that natural isolates carrying these mutations be further evaluated. Our results demonstrate that a highly pathogenic avian H7 virus can become airborne transmissible in a mammalian host, and support on-going surveillance and pandemic H7 vaccine development.

    Importance: The major findings of this report are that a highly pathogenic strain of H7N1 avian influenza can be adapted to become airborne transmissible in mammals without mutations altering the receptor specificity. Changes in receptor specificity have been shown to play a role in the ability of avian influenza viruses to cross the species barrier and these changes are assumed to be essential. The work herein challenges this paradigm, at least for the influenza viruses of the H7 subtype, which have recently become the focus of major attention as they have crossed to humans.

  • Sequence Changes Associated with Respiratory Transmission of H7N1 Influenza Virus in Mammals [PublishAheadOfPrint]

  • In this issue of the Journal of Virology, we publish a paper by Troy C. Sutton and colleagues from the University of Maryland, Virginia-Maryland College of Veterinary Medicine, and the Istituto Zooprofilattico Sperimentale delle Venezie in Padova, Italy reporting sequence changes in highly pathogenic avian influenza virus A H7N1 (A/H7N1) associated with airborne transmission in mammals (1)....

  • On the need for a national board to assess dual use research of concern (DURC) [PublishAheadOfPrint]

  • After dispersal of anthrax spores through the U.S. mail in 2001, there was heightened awareness of the potential of biological knowledge to be used for nefarious purposes....

  • Permissiveness of human cancer cells to oncolytic Bovine herpes virus type 1 is mediated in part by KRAS activity [PublishAheadOfPrint]

  • Oncolytic viruses (OV) are attractive avenues of cancer therapy due to the absence of toxic side effects often seen in current treatment modalities. Bovine herpesvirus type 1 (BHV-1) is a species-specific virus that does not induce cytotoxicity in normal primary human cells, but can infect and kill various human immortalized and transformed cell lines. To gain a better understanding of the oncolytic breadth of BHV-1, the NCI panel of established human tumor cell lines was screened for sensitivity to the virus. Overall, 72% of the panel is permissive to BHV-1 infection with corresponding decreases in cellular viability. This sensitivity is in comparison to only 32% for an HSV-1 based oncolytic vector. Strikingly, while 35% of the panel supports minimal or no BHV-1 replication, significant decreases in cellular viability still occur. These data suggest that BHV-1 is an OV with tropism for multiple tumor types and is able to induce cytotoxicity independent of significant virus replication. In contrast to other species-specific OVs, cellular sensitivity to BHV-1 does not correlate with type I IFN signaling; however, mutations in KRAS were found to correlate with high levels of virus replication. The knockdown or overexpression of KRAS in human tumor cell lines yields modest changes in viral titres; however, overexpression of KRAS in normal primary cells elicits permissivity to BHV-1 infection. Together these data suggest that BHV-1 is a broad spectrum OV with a distinct mechanism of tumor targeting.

    Importance Cancer remains a significant health issue and novel treatments are required, particularly against tumors that are refractory to conventional therapies. Oncolytic viruses are a novel platform given their ability to specifically target tumor cells, while leaving healthy cells intact. For this strategy to be successful, a fundamental understanding of virus-host interactions is required. We previously identified Bovine herpesvirus type 1 as a novel oncolytic virus with many unique and clinically relevant features. Here, we show that BHV-1 can target a wide range of human cancer types, most potently lung cancer. In addition, we show that enhanced KRAS activity, a hallmark of many cancers, is one of the factors that increases BHV-1 oncolytic capacity. These findings hold potential for future treatments, particularly in the context of lung cancer, where KRAS mutations are a negative predictor of treatment efficacy.

  • HIV-1 Tat Protein Induces PD-L1 (B7-H1) Expression on Dendritic Cells Through TNF-{alpha} and TLR4 Mediated Mechanisms [PublishAheadOfPrint]

  • Chronic HIV-1 infection is associated with induction of T-cell co-inhibitory pathways. However, the mechanisms by which HIV-1 induces up-regulation of co-inhibitory molecules remain to be fully elucidated. The aim of the present study was to determine whether and how HIV-1 Tat protein, an immunosuppressive viral factor, induces the PD-1/PD-L1 co-inhibitory pathway on human dendritic cells (DCs).

    We found that treatment of DCs with whole HIV-1 Tat protein significantly up-regulated the level of expression of PD-L1. This PD-L1 up-regulation was observed in monocyte-derived dendritic cells (MoDCs) obtained from either uninfected or HIV-1 infected patients as well as in primary myeloid DCs from HIV negative donors. In contrast, no effect on the expression of PD-L2 or PD-1 molecules was detected. The induction of PD-L1 on MoDCs by HIV-1 Tat: (i) occurred in a dose- and time-dependent manners; (ii) was mediated by the N-terminal 1-45 fragment of Tat; (iii) did not require direct cell-cell contact but appeared rather to be mediated by soluble factor(s); (iv) was abrogated following neutralization of TNF-aalpha; or blocking of TLR4; (v) was absent in TLR4 KO mice but could be restored following incubation with Tat-conditioned medium from wild-type DCs; (vi) impaired the capacity of MoDCs to functionally stimulate T-cells; and (vii) was not reversed functionally, following PD-1/PD-L1 pathway blockade, suggesting the implication of other Tat-mediated co-inhibitory pathways.

    Our results demonstrate that HIV-1 Tat protein upregulates PD-L1 expression on MoDCs, through TNF-aalpha; and TLR4 mediated-mechanisms, functionally compromising the ability of DCs to stimulate T-cells. The findings offer a novel potential molecular target for the development of an anti-HIV-1 treatment.

    IMPORTANCE: The objective of this study was to investigate the effect HIV-1 Tat on the PD-1/PD-L1 co-inhibitory pathway on human monocyte-derived dendritic cells (MoDCs). We found that treatment of MoDCs from either healthy or HIV-1 infected patients with HIV-1 Tat protein stimulated the expression of PD-L1. We demonstrates that this stimulation was mediated through an indirect mechanism, involving TNF-aalpha; and TLR4 pathways and resulted in compromised ability of Tat-treated MoDCs to functionally stimulate T-cell proliferation.

  • Protein-protein interactions leading to the recruitment of the host DNA sliding clamp by the hyperthermophilic archaeal virus SIRV2 [PublishAheadOfPrint]

  • Viruses infecting hyperthermophilic archaea typically do not encode DNA polymerases, raising questions regarding their genome replication. Here, using a yeast two-hybrid approach we have assessed interactions between proteins of Sulfolobus islandicus rod-shaped virus 2 (SIRV2) and the host-encoded proliferating cell nuclear antigen (PCNA), a key DNA replication protein in archaea. Five SIRV2 proteins were found to interact with PCNA, providing insights into the recruitment of host replisome for viral DNA replication.

  • The impact of the hepatitis B virus polymerase rtA181T mutation on replication and drug resistance is potentially affected by overlapping changes in surface gene [PublishAheadOfPrint]

  • The emergence of drug-resistant hepatitis B virus (HBV) is a major problem for antiviral treatment in chronic hepatitis B infection. In this study, we analyzed the evolution of drug-resistant mutations and characterized the effects of the rtA181T and rtI233V mutations on viral replication and drug resistance.

    We performed a clonal analysis of the HBV polymerase gene from serum samples during viral breakthrough treated with antiviral agents. A series of mutant clones containing rtA181T and/or rtI233V mutations were constructed and determined the effect of these mutations on the replication ability and drug resistance.

    An in vitro study revealed that the effect of the rtA181T mutation on viral replication and drug resistance is dependent on the mutations in the overlapping surface gene. Compared to the rtA181T surface missense mutation (rtA181T/sW172S), the introduction of rtA181T surface nonsense mutation (rtA181T/sW172*) resulted in decreased viral replication and increased drug resistance. Complementation assay revealed that the truncated PreS1 is responsible for reduced replication of rtA181T/sW172* mutant. Moreover, the rtA181T/sW172* mutant exhibited a defect in viral particle secretion. The rtI233V mutation that emerged during adefovir therapy reduced viral replication and conferred resistance to adefovir.

    Our data suggest that the impact of the rtA181T mutation on replication and drug resistance differs based on the mutation status of the corresponding surface gene. The rtI233V mutation also affects replication ability and drug resistance. This observation suggests the need for genotypic analysis of overlapping surface genes to manage antiviral drug resistance if clinical isolates harbor the rtA181T mutation.

    Importance The emergence of drug-resistant HBV that are no longer susceptible to nucleos(t)ide analogues is a major problem for antiviral treatment in chronic hepatitis B infection. Among drug resistant mutations, the single rtA181T mutation is known to confer cross-resistance to antiviral drugs. This mutation causes intermediate or reduced susceptibility to tenofovir. Moreover, the clinical occurrence of the rtA181T mutation during antiviral therapy is also high. Our study revealed that the effect of the rtA181T mutation on viral replication and drug resistance is dependent on the mutations in the overlapping surface gene. This observation suggests the need for genotypic analysis of overlapping surface genes to manage antiviral drug resistance if clinical isolates harbor the rtA181T mutation. We believe that our study will not only extend the understanding of the drug resistance mechanism, but it will also ultimately provide new treatment options for patients with multidrug resistant HBV.

  • Imaging the Alphavirus Exit Pathway [PublishAheadOfPrint]

  • Alphaviruses are small enveloped RNA viruses with highly organized structures that exclude host cell proteins. They contain an internal nucleocapsid and an external lattice of the viral E2 and E1 transmembrane proteins. Alphavirus bud from the plasma membrane (PM) but the process and dynamics of alphavirus assembly and budding are poorly understood. Here we generated Sindbis viruses (SINV) with fluorescent protein labels on the E2 envelope protein and exploited them to characterize virus assembly and budding in living cells. During virus infection E2 became enriched in localized patches on the PM and in filopodia-like extensions. These E2-labeled patches and extensions contained all of the viral structural proteins. Correlative light and electron microscopy studies established that the patches and extensions co-localized with virus budding structures, while light microscopy showed that they excluded a freely-diffusing PM marker protein. Exclusion required the interaction of the E2 protein with the capsid protein, a critical step in virus budding, and was associated with the immobilization of the envelope proteins on the cell surface. Virus infection induced two distinct types of extensions: tubulin-negative extensions that were ~2-4 mmu;m in length and excluded the PM marker, and tubulin-positive extensions that were ggt;10 mmu;m long, contained the PM marker, and could transfer virus particles to non-infected cells. Tubulin-positive extensions were selectively reduced in cells infected with a non-budding SINV mutant. Together our data support a model in which alphavirus infection induces reorganization of the PM and cytoskeleton leading to virus budding from specialized sites.

    IMPORTANCE Alphaviruses are important and widely distributed human pathogens for which vaccines and antiviral therapies are urgently needed. These small highly organized viruses bud from the host cell PM. Virus assembly and budding are critical but little understood steps in the alphavirus lifecycle. We developed alphaviruses with fluorescent protein tags on one of the viral membrane (envelope) proteins and used a variety of microscopy techniques to follow the envelope protein and a host cell PM protein during budding. We showed that alphavirus infection induced the formation of patches and extensions on the PM where the envelope proteins accumulate. These sites excluded other PM proteins and correlated with virus budding structures. Exclusion of PM proteins required specific interactions of the viral envelope proteins with the internal capsid protein. Together our data indicate that alphaviruses extensively reorganize the cell surface and cytoskeleton to promote their assembly and budding.

  • Live Attenuated Tetravalent Dengue Virus Host Range Vaccine is Immunogenic in African Green Monkeys Following a Single Vaccination [PublishAheadOfPrint]

  • The causative agent of dengue fever, dengue virus (DENV), is transmitted by mosquitoes, and as distribution of these insects has expanded, so has dengue related disease. DENV is a member of the Flavivirus family and has 4 distinct serotypes (DENV-1, 2, 3 and 4). No lasting cross protection is afforded to heterologous serotypes following infection by any one of the individual serotypes. The presence of non-neutralizing antibodies to one serotype can facilitate the occurrence of more severe dengue hemorrhagic fever through immune enhancement upon infection with a second serotype. For this reason, the development of a safe, tetravalent vaccine to produce a balanced immune response to all four serotypes is critical. We have developed a novel approach to produce safe and effective live-attenuated vaccines for DENV and other insect-borne viruses. Host range (HR) mutants of each DENV serotype were created by truncating transmembrane domain 1 of the E protein and selecting for strains of DENV that replicated well in insect cells but not mammalian cells. These vaccine strains were tested for immunogenicity in African Green Monkeys (AGMs). No vaccine related adverse events occurred. The vaccine strains were confirmed to be attenuated in vivo by infectious center assay (ICA). Analysis by PRNT50 established that by day 62 post-vaccination, 100% of animals seroconverted to DENV-1, 2, 3, and 4. Additionally, the DENV HR tetravalent vaccine (HR-Tet) showed a tetravalent anamnestic immune response in 100% (16/16) of AGMs after challenge with WT DENV strains.

    IMPORTANCE We have generated a live attenuated viral vaccine (LAV)capable of eliciting a strong immune response in African Green Monkeys (AGM) in a single dose. This vaccine is delivered by injecting one of four attenuated serotypes into each limb of the animal. 100% of animals given the vaccine generated antibodies against all 4 serotypes, and this response was found to be balanced in nature. This is also one of the first studies of dengue in AGM, and our study suggests that viremia and antibody response in AGM may be similar to DENV infection in humans.

  • CD4-mimetic Small Molecules Sensitize Human Immunodeficiency Virus (HIV-1) to Vaccine-elicited Antibodies [PublishAheadOfPrint]

  • Approaches to prevent human immunodeficiency virus (HIV-1) transmission are urgently needed. Difficulties in eliciting antibodies that bind conserved epitopes exposed on the unliganded conformation of the HIV-1 envelope glycoprotein (Env) trimer represent barriers to vaccine development. During HIV-1 entry, binding of the gp120 Env to the initial receptor, CD4, triggers conformational changes in Env that result in the formation and exposure of the highly conserved gp120 site for interaction with the coreceptors, CCR5 or CXCR4. The DMJ compounds, (+)-DMJ-I-228 and (+)-DMJ-II-121, bind gp120 within the conserved Phe 43 cavity near the CD4-binding site, block CD4 binding and inhibit HIV-1 infection. Here we show that the DMJ compounds sensitize primary HIV-1, including transmitted/founder viruses, to neutralization by monoclonal antibodies directed against CD4-induced (CD4i) epitopes and the V3 region, two gp120 elements involved in coreceptor binding. Importantly, the DMJ compounds rendered primary HIV-1 sensitive to neutralization by antisera elicited by immunization of rabbits with HIV-1 gp120 cores engineered to assume the CD4-bound state. Thus, small molecules like the DMJ compounds may be useful as microbicides to inhibit HIV-1 infection directly and to sensitize primary HIV-1 to neutralization by readily elicited antibodies.

    IMPORTANCE Preventing human immunodeficiency virus (HIV-1) transmission is a priority for global health. Eliciting antibodies that can neutralize many different strains of HIV-1 is difficult, creating problems for the development of a vaccine. We found that certain small-molecule compounds can sensitize HIV-1 to particular antibodies. These antibodies can be elicited in rabbits. These results suggest an approach to prevent HIV-1 sexual transmission in which a virus-sensitizing microbicide is combined with a vaccine.

  • Novel Roles of Focal Adhesion Kinase in Cytoplasmic Entry and Replication of Influenza A Viruses [PublishAheadOfPrint]

  • Viruses modulate cellular signaling pathways at almost every step of the infection cycle. Cellular signaling pathways activated at later times of influenza infections have previously been investigated; however, early influenza virus-host cell interactions remain understudied. Focal adhesion kinase (FAK) is a cytoplasmic tyrosine kinase that regulates Phosphatidyl-inositol-3-kinase (PI3K) activation and actin reorganization, two critical processes during influenza A virus (IAV) infection in most cell types. Using 6 influenza A virus strains [A/Puerto Rico/8/1934, A/Aichi/2/1968 x A/Puerto Rico/8/1934 reassortant (X-31), A/California/04/2009, mouse-adapted A/California/04/2009, A/WSN/1933, A/New Caledonia/20/1999], we examined the role of FAK during IAV entry. We found that influenza virus attachment induced PI3K-dependent FAK-Y397 phosphorylation. Pharmacological FAK inhibition or expression of a kinase-dead mutant of FAK led to disruption of the actin meshwork that resulted in sequestration of IAV at the cell periphery and reduced virion localization to early endosomes. Additionally, FAK inhibition impeded viral RNA replication at later times of infection and ultimately resulted in significantly reduced viral titers in both A549 and differentiated normal human bronchial epithelial (NHBE) cells. Although not all tested strains activated FAK, all of them exhibited a reduction in viral replication in response to inhibition of FAK signaling. These findings highlight novel biphasic roles of FAK activation during IAV infection and indicate that FAK serves as a central link between receptor-mediated PI3K activation and actin reorganization during IAV infection.

    IMPORTANCE We found that FAK links early activation of PI3K and actin reorganization thereby regulating influenza virus entry. Surprisingly, we also found that FAK can regulate viral RNA replication independently of its role in entry. Our study addresses a knowledge gap in the understanding of signaling events triggered by influenza virus which mediate its internalization and initiation of the infection cycle. Understanding of these fundamental molecular events will be necessary to identify novel host targets, such as FAK, and development of future anti-influenza therapeutics.

  • Ebolavirus Entry Requires a Compact Hydrophobic Fist at the Tip of the Fusion Loop [PublishAheadOfPrint]

  • Ebolavirus is an enveloped virus causing severe hemorrhagic fever. Its surface glycoproteins undergo proteolytic cleavage and rearrangements to permit membrane fusion and cell entry. Here we focus on the glycoprotein's internal fusion loop (FL), critical for low pH-triggered fusion in the endosome. Alanine mutations at L529, I544, and particularly the double mutant L529/I544 compromised viral entry and fusion. The NMR structures of I544A and L529A/I544A in lipid environments showed significant disruption of a three-residue scaffold that is required for the formation of a consolidated fusogenic hydrophobic surface at the tip of the FL. Biophysical experiments and molecular simulation revealed the position of the WT FL in membranes and showed the inability of the inactive double mutant to reach this position. Consolidation of hydrophobic residues at the tip of FLs may be a common requirement for internal FLs of class I, II, and III fusion proteins.

    IMPORTANCE: Many class I, II, and III viral fusion proteins bear fusion loops for target membrane insertion and fusion. We determined structures of the Ebolavirus fusion loop and found residues critical for forming a consolidated hydrophobic surface, membrane insertion, and viral entry.

  • Innate nuclear sensor IFI16 translocates into the cytoplasm during early stage of in vitro HCMV infection and is entrapped in the egressing virions during late stage. [PublishAheadOfPrint]

  • Intrinsic immune mechanisms mediated by constitutively expressed proteins termed "restriction factors" provide frontline antiviral defense. We recently demonstrated that the DNA sensor IFI16 restricts HCMV replication by down-regulating viral early and late but not immediate-early mRNAs and their protein expression. Here, we show that at an early time point during the in vitro infection of low-passage human embryonic lung fibroblasts (HELF), IFI16 binds to HCMV DNA. However, during a later phase following infection, IFI16 is mislocalized to the cytoplasmic virus assembly complex (AC), where it colocalizes with viral structural proteins. Indeed, upon its binding to pUL97, IFI16 undergoes phosphorylation and relocalizes to the cytoplasm of HCMV-infected cells. ESCRT (Endosomal Sorting Complex Required for Transport) machinery regulates the translocation of IFI16 into the virus AC by sorting and trafficking IFI16 into multivesicular bodies (MVB), as demonstrated by the interaction of IFI16 with two MVB markers: Vps4 and TGN46. Finally, IFI16 becomes incorporated into the newly assembled virions as demonstrated by Western blot analysis of purified virions and electron microscopy. Together, these results suggest that HCMV has evolved mechanisms to mislocalize and hijack IFI16, trapping it within mature virions. However, the significance of this IFI16 trapping following nuclear mislocalization remains to be established.

    IMPORTANCE Intracellular viral DNA sensors and restriction factors are critical components of host defence, which alarm and sensitize immune system against intruding pathogens. We have recently demonstrated that the DNA sensor IFI16 restricts HCMV replication by down-regulating viral early and late but not immediate-early mRNAs and their protein expression. However, viruses are known to evolve numerous strategies to cope and counteract such restriction factors and neutralize the first line of host defence mechanisms. Our findings describe that during early stages of infection, IFI16 successfully recognizes HCMV DNA. However, in late stages HCMV mislocalizes IFI16 into the cytoplasmic viral assembly complex (AC) and finally entraps the protein into mature virions. This work clarifies the mechanisms HCMV relies to overcome intracellular viral restriction, which provides new insights about the relevance of DNA sensors during HCMV infection.

  • Differential contribution of Tacaribe arenavirus Nucleoprotein N-terminal and C-terminal residues to nucleocapsid functional activity [PublishAheadOfPrint]

  • The arenavirus Nucleoprotein (NP) is the main protein component of viral nucleocapsids and is strictly required for viral genome replication mediated by the L polymerase. Homo-oligomerization of NP is presumed to play an important role in nucleocapsid assembly, albeit the underlining mechanism and the relevance of NP-NP interaction in nucleocapsid activity are still poorly understood. Here, we evaluate the contribution of the New World Tacaribe virus (TCRV) NP self-interaction to nucleocapsid functional activity. We show that alanine substitution of N-terminal residues predicted to be available for NP-NP interaction strongly affected NP self-association, as determined by coimmunoprecipitation assays, produced a drastic inhibition of transcription and replication of a TCRV minigenome RNA and impaired NP binding to RNA. Mutagenesis and functional analysis also revealed that, while dispensable for NP self-interaction, key amino acids at the C-terminal domain were essential for RNA synthesis. Furthermore, mutations at these C-terminal residues rendered NP unable to bind RNA both in vivo and in vitro, but had no effect on the interaction with the L polymerase. In addition, while all oligomerization-defective variants tested exhibited unaltered capacities to sustain NP-L interaction, deletion NP mutants were fully incompetent to bind L, suggesting that, whereas NP self-association is dispensable, the integrity of both the N-terminal and C-terminal domains is required for binding the L polymerase. Overall, our results suggest that NP self-interaction mediated by the N-terminal domain may play a critical role in TCRV nucleocapsid assembly and activity, and that the C-terminal domain of NP is implicated in RNA binding.

    Importance The mechanism of arenavirus functional nucleocapsid assembly is still poorly understood. No detailed information is available on the nucleocapsid structure and the regions of full-length NP involved in binding to viral RNA remain to be determined. In this report, novel findings are provided on critical interactions between the viral ribonucleoprotein components. We identify several amino acid residues in both the N-terminal and C-terminal domains of TCRV NP that differentially contribute to NP-NP and NP-RNA interactions and analyze their relevance for binding of NP to the L polymerase and for nucleocapsid activity. Our results provide insight into the contribution of NP self-interaction to RNP assembly and activity, and reveal the involvement of the NP C-terminal domain in RNA binding.

  • Characterizing functional domains for TIM-mediated enveloped virus entry [PublishAheadOfPrint]

  • T-cell immunoglobulin and mucin domain 1 (TIM-1) and other TIM family members were recently identified as phosphatidylserine (PtdSer)-mediated virus entry enhancing receptors (PVEERs). These proteins enhance entry of Ebola virus (EBOV) and other viruses by binding PtdSer on the viral envelope, concentrating virus on the cell surface, and promoting subsequent internalization. The PtdSer binding activity of the IgV domain is essential for both virus binding and internalization by TIM-1. However, TIM-3, whose IgV domain also binds PtdSer, does not effectively enhance virus entry indicating that other domains of TIM proteins are functionally important. Here, we investigate the domains supporting enhancement of enveloped virus entry, thereby defining the features necessary for a functional PVEER. Using a variety of chimeras and deletion mutants, we found that in addition to a functional PtdSer binding domain PVEERs require a stalk domain of sufficient length, containing sequences that promote an extended structure. Neither the cytoplasmic nor transmembrane domain of TIM-1 is essential for enhancing virus entry, provided the protein is still plasma membrane bound. Based on these defined characteristics, we generated a mimic lacking TIM sequences and composed of Annexin V, the mucin like domain of aalpha;-dystroglycan, and a glycophosphatidylinositol anchor that functioned as a PVEER to enhance transduction of virions displaying Ebola, Chikungunya, Ross River, or Sindbis virus glycoproteins. This identification of the key features necessary for PtdSer-mediated enhancement of virus entry provides a basis for more effective recognition of unknown PVEERs.

    IMPORTANCE (nontechnical, 150 word limit): T-cell immunoglobulin and mucin domain 1 (TIM-1) and other TIM family members are recently identified phosphatidylserine (PtdSer)-mediated virus entry enhancing receptors (PVEERs). These proteins enhance virus entry by binding the phospholipid, PtdSer, present on the viral membrane. While it is known that the PtdSer binding is essential for the PVEER function of TIM-1, TIM-3 shares this binding activity but does not enhance virus entry. No comprehensive studies have been done to characterize the other domains of TIM-1. In this study, using a variety of chimeric proteins and deletion mutants, we define the features necessary for a functional PVEER. With these features in mind, we generated a TIM-1 mimic using functionally similar domains from other proteins. This mimic, like TIM-1, effectively enhanced transduction. These studies provide insight into the key features necessary for PVEERs and will allow for more effective identification of unknown PVEERs.

  • Dysfunction of bovine endogenous retrovirus K2 envelope glycoprotein is related to unsuccessful intracellular trafficking [PublishAheadOfPrint]

  • Endogenous retroviruses (ERVs) are the remnants of retroviral infection into ancestral germ cells. Mutations introduced into ERVs halt the production of infectious agents, but their effects on the function of retroviral proteins are not fully understood. Retroviral envelope glycoproteins (Env) are utilized in membrane fusion during viral entry, and we recently identified intact coding sequences for bovine endogenous retrovirus (BERV) -K1 and -K2 Envs. Amino acid sequences of BERV-K1 Env (also called Fematrin-1) and BERV-K2 Env are similar, and both are classified into the genus Betaretrovirus. While Fematrin-1 plays an important role in cell-to-cell fusion in bovine placenta, BERV-K2 envelope gene is marginally expressed in vivo and its recombinant Env is defective in membrane fusion due to inefficient cleavage of surface (SU) and transmembrane subunits. Here, we conducted chimeric analyses of Fematrin-1 and BERV-K2 Envs and revealed that defective maturation of BERV-K2 Env contributed to failed intracellular trafficking. Fluorescence microscopy and flow cytometric analysis suggested that, in contrast to Fematrin-1 Env, BERV-K2 Env could not be transported from the endoplasmic reticulum to the trans-Golgi network, where cellular proteases required for processing retroviral Envs are localized. We also identified that one of the responsive regions of this phenomenon resided within a 65 amino acid region of BERV-K2 SU. This is the first report to identify that retroviral Env SU is involved in the regulation of intracellular trafficking, and may help to elucidate the maturation process of Fematrin-1 and other related Envs.

    Importance Retroviruses utilize envelope glycoproteins (Envs) to enter host target cells. Mature retroviral Env is a heterodimer, which consists of surface (SU) and transmembrane (TM) subunits that are generated by the cleavage of an Env precursor protein in the trans-Golgi network. SU and TM mediate the recognition of the entry receptor and viral-host membrane fusion, respectively. However, unexplained issues remain in the maturation process of retroviral Env. We previously reported that bovine endogenous retrovirus (BERV)-K2 Env lost fusogenicity due to a defect in the cleavage of SU and TM. In this study, we identified that mutations residing in BERV-K2 SU disturbed intracellular trafficking of BERV-K2 Env, and resulted its inefficient cleavage. Because SU is not known to play an important role in this process, our study may provide novel insights into the maturation mechanism of retroviral Envs.

  • Inhibition of KAP1 enhances hypoxia-induced KSHV reactivation through RBP-J{kappa} [PublishAheadOfPrint]

  • Hypoxia-inducible factor (HIF) aalpha; has been frequently implicated in many cancers as well as viral pathogenesis. Kaposirrsquo;s sarcoma-associated herpesvirus (KSHV) is linked to several human malignancies. It can stabilize HIF-1aalpha; during latent infection and undergoes lytic replication in response to hypoxic stress. However, the mechanism by which KSHV controls its latent and lytic life cycle through the deregulation of HIF-1aalpha; is not fully understood. Our previous studies showed that the hypoxia-sensitive chromatin remodeler KAP1 was targeted by the KSHV encoded latent antigen LANA to repress expression of the major lytic regulator RTA. Here we further report that an RNA interference-based knockdown of KAP1 in KSHV-infected PEL cells disrupted viral episome stability and abrogated subG1/G1 arrest of the cell cycle, while increasing the efficiency of KSHV lytic reactivation by hypoxia or using the chemical TPA/NaB. Moreover, KSHV genome-wide screening revealed that four hypoxia-responsive clusters have a high concurrence of both RBP-J and HIF-1aalpha; binding sites (RBS+HRE) within the same gene promoter and are tightly associated with KAP1. Inhibition of KAP1 greatly enhanced the association of RBP-J with the HIF-1aalpha; complex for driving RTA expression not only in normoxia but also in hypoxia. These results suggest that both KAP1 and the concurrence of RBS+HRE within the RTA promoter are essential for KSHV latency and hypoxia-induced lytic reactivation.

    IMPORTANCE Kaposirrsquo;s sarcoma-associated herpesvirus (KSHV), a DNA tumor virus, is the etiological agent linked to several human malignancies including Kaposirrsquo;s sarcoma (KS) and primary effusion lymphoma (PEL). HIF-1aalpha;, a key hypoxia-inducible factor, is frequently elevated in KSHV latently infected tumor cells and contributes to KSHV lytic replication in hypoxia. The molecular mechanisms of how KSHV controls the latent and lytic life cycle through deregulating HIF-1aalpha; remains unclear. In this study, we found that inhibition of hypoxia-sensitive chromatin remodeler KAP1 in KSHV-infected PEL cells leads to loss of viral genome, and increases its sensitivity to hypoxic stress leading to KSHV lytic reactivation. Importantly, we also found that four hypoxia-responsive clusters within the KSHV genome contain a high concurrence of both RBP-J (a key cellular regulator involved in Notch signaling) and HIF-1aalpha; binding sites. These sites are also tightly associated with KAP1. This discovery implies that KAP1, RBP-J and HIF-1aalpha; play an essential role in KSHV pathogenesis through subtle cross talk which is dependent on the oxygen levels in the infected cells.

  • Site-Specific Association with Host and Viral Chromatin by KSHV LANA and its Reversal during Lytic Reactivation [PublishAheadOfPrint]

  • Latency-associated nuclear antigen (LANA), a multifunctional protein expressed by the Kaposi sarcoma-associated herpesvirus (KSHV) in latently-infected cells, is required for stable maintenance of the viral episome. This is mediated by two interactions: LANA binds to specific sequences (LBS1 and 2) on viral DNA, and also engages host histones, tethering the viral genome to host chromosomes in mitosis. LANA has also been suggested to affect host gene expression, but both the mechanism(s) and role of this dysregulation in KSHV biology remain unclear. Here we have examined LANA interactions with host chromatin on a genome-wide scale using ChIP-seq, and show that LANA predominantly targets human genes near their transcriptional start sites (TSSs). These host LANA-binding sites are generally found within transcriptionally active promoters and display striking overrepresentation of a consensus DNA sequence virtually identical to the LBS1 motif in KSHV DNA. Comparison of the ChIP-seq profile with whole transcriptome (RNA-seq) data reveals that few of the genes that are differentially regulated in latent infection are occupied by LANA at their promoters. This suggests that direct LANA binding to promoters is not the prime determinant of altered host transcription in KSHV-infected cells. Most surprisingly, the association of LANA to both host and viral DNA is strongly disrupted during the lytic cycle of KSHV. This disruption can be prevented by the inhibition of viral DNA synthesis, suggesting the existence of novel and potent regulatory mechanisms linked to either viral DNA replication or late gene expression.

    IMPORTANCE Here, we employ complementary genome-wide analyses to evaluate the distribution of the highly abundant latency associated nuclear antigen, LANA on the host genome and its impact on host gene expression during KSHV latent infection. Combined, ChIP-seq and RNA-seq reveal that LANA accumulates at active gene promoters that harbor specific short DNA sequences that are highly reminiscent of its cognate binding sites in the virus genome. Unexpectedly, we found that such association does not lead to remodeling of global host transcription during latency. We also report for the first time that LANArrsquo;s ability to bind host and viral chromatin is highly dynamic, and is disrupted in cells undergoing an extensive lytic reactivation. This therefore suggests that the association of LANA to chromatin during a productive infection cycle is controlled by a new regulatory mechanism.

  • Efficient norovirus and reovirus replication in the mouse intestine requires microfold (M) cells [PublishAheadOfPrint]

  • Microfold (M) cells are specialized intestinal epithelial cells that internalize particulate antigens and aid in the establishment of immune responses to enteric pathogens. M cells have also been suggested as a portal for pathogen entry into the host. While virus particles have been observed in M cells, it is not known whether viruses use M cells to initiate a productive infection. Noroviruses (NoVs) are single-stranded RNA viruses that infect host organisms via the fecal-oral route. Murine NoV (MNV) infects intestinal macrophages and dendritic cells and provides a tractable experimental system for understanding how an enteric virus overcomes the intestinal epithelial barrier to infect underlying target cells. We found that replication of two divergent MNV strains was reduced in mice depleted of M cells. Reoviruses are double-stranded RNA viruses that infect hosts via respiratory or enteric routes. In contrast to MNV, reovirus infects enterocytes in the intestine. Despite differences in cell tropism, reovirus infection was also reduced in M cell-depleted mice. These data demonstrate that M cells are required for the pathogenesis of two unrelated enteric viruses that replicate in different cell types within the intestine.

    Importance To successfully infect their hosts, pathogens that infect via the gastrointestinal tract must overcome the multi-layered system of host defenses. Microfold (M) cells are specialized intestinal epithelial cells that internalize particulate antigens and aid in the establishment of immune responses to enteric pathogens. Virus particles have been observed within M cells. However, it is not known whether viruses use M cells to initiate a productive infection. To address this question, we use murine norovirus (MNV) and reovirus, two enteric viruses that replicate in different cell types in the intestine, intestinal epithelial cells for reovirus and intestinal mononuclear phagocytes for MNV. Interestingly, MNV- and reovirus-infected mice depleted of M cells showed reduced viral loads in the intestine. Thus, our work demonstrates the importance of M cells in the pathogenesis of enteric viruses irrespective of the target cell type in which the virus replicates.

  • Rab18 Facilitates Dengue Virus Infection by Targeting Fatty Acid Synthase to Sites of Viral Replication [PublishAheadOfPrint]

  • Positive-sense RNA viruses, such as dengue virus (DENV), hijack the intracellular membrane machinery for their own replication. Rab18 protein, a member of the Rab GTPases family, key regulators of membrane trafficking, is located on the organelles involved in DENV infection, such as the endoplasmic reticulum (ER) and lipid droplets (LDs). In this study, we addressed the potential involvement of Rab18 in DENV infection by using cells overexpressing the wild-type, GTP-bound active form or GDP-bound inactive form of Rab18 and cells with Rab18 knockdown. DENV replication, measured by viral protein, viral RNA and viral progeny production, as well as LDs induction were reduced in cells with inactive Rab18 and in cells deprived of Rab18 expression, suggesting a positive role of Rab18 in the DENV life cycle. Interestingly, the interaction of fatty acid synthase (FASN), a key lipogenic enzyme in lipid biosynthesis, with DENV NS3 protein relied on the conversion of GDP-bound to GTP-bound form of Rab18. Furthermore, the targeting of FASN to sites participated in DENV infection, such as the ER and LDs, depends on functional Rab18. Thus, Rab18-mediated membrane trafficking of FASN and NS3 facilitates DENV replication, probably by ensuring a sufficient and coordinated lipid supply for membrane proliferation and arrangement.

    Importance: Infection of dengue virus (DENV), an important mosquito-borne virus threatening ~40% of the worldrrsquo;s population, can cause mild dengue fever or severe dengue hemorrhagic fever and dengue shock syndrome. The pathogenesis mechanisms of DENV-related diseases are not clear, but high viral replication is believed to be a risk factor for the severe form of DENV infection. Thus, understanding the detailed mechanism of DENV replication might help address this devastating virus. Here, we find that Rab18, a small GTPase involved in vesicle trafficking and located in the endoplasmic reticulum network and on the surface of lipid droplets, positively regulates DENV replication. The functional machinery of Rab18 is required to recruit the enzyme fatty acid synthase to sites of DENV replication and interact with DENV NS3 protein to promote fatty acid biosynthesis. Thus, DENV usurps Rab18 to facilitate its own replication.

  • ROCK1 and LIM Kinase Modulate Retrovirus Particle Release and Cell-Cell Transmission Events [PublishAheadOfPrint]

  • The assembly and release of retroviruses from the host cells requires dynamic interactions between viral structural proteins and a variety of cellular factors. It has been long speculated that the actin cytoskeleton is involved in retrovirus production, and actin and actin-related proteins are enriched in HIV-1 virions. However, the specific role of actin in retrovirus assembly and release remains unknown. Here we identified LIM Kinase-1 (LIMK1) as a cellular factor regulating HIV-1 and Mason-Pfizer monkey virus (M-PMV) particle release. Depletion of LIMK1 reduced not only particle output but also virus cell-cell transmission, and was rescued by LIMK1 replenishment. Depletion of the upstream LIMK1 regulator ROCK1 inhibited particle release, as did a competitive peptide inhibitor of LIMK1 activity that prevented cofilin phosphorylation. Disruption of either ROCK1 or LIMK1 led to enhanced particle accumulation on the plasma membrane as revealed by total internal reflection fluorescence microscopy (TIRFM). Electron microscopy demonstrated a block to particle release, with clusters of fully mature particles on the surface of the cells. Our studies support a model in which ROCK1 and LIMK1-regulated phosphorylation of cofilin and subsequent local disruption of dynamic actin turnover plays a role in retrovirus release from host cells and in cell-cell transmission events.

    IMPORTANCE: Viruses often interact with cellular cytoskeletal machinery in order to deliver their components to the site of assembly and budding. This study indicates that a key regulator of actin dynamics at the plasma membrane, LIM kinase, is important for the release of viral particles for HIV as well as for particle release by distantly-related retrovirus, Mason-Pfizer monkey virus. Moreover, disruption of LIM kinase greatly diminished the spread of HIV from cell-to-cell. These findings suggest that LIM kinase and its dynamic modulation of the actin cytoskeleton in the cell may be an important host factor for the production, release, and transmission of retroviruses.

  • The Thr205 Phosphorylation Site Within Respiratory Syncytial Virus Matrix (M) Protein Modulates M Oligomerization and Virus Production [PublishAheadOfPrint]

  • Human respiratory syncytial virus (RSV) is the most common cause of bronchiolitis and pneumonia in infants and elderly worldwide; however there is no licensed RSV vaccine or effective drug treatment available. The RSV Matrix (M) protein plays key roles in virus assembly and budding, but the protein interactions that govern budding of infectious virus are not known. In this study we focus on M protein and identify a key phosphorylation site (Thr205) in M that is critical for RSV infectious virus production. Recombinant virus with a nonphosphorylatable Alanine (Ala) residue at the site was markedly attenuated, whereas virus with a phosphomimetic Aspartate (Asp) resulted in a non-viable virus which could only be recovered with an additional mutation in M (Serine to Asparagine at position 220), strongly implying that Thr205 is critical for viral infectivity. Experiments in vitro showed that mutation of Thr205 does not affect M stability or the ability to form dimers, but implicate an effect on higher order oligomer assembly. In transfected and infected cells, Asp substitution of Thr205 appeared to impair M oligomerization; typical filamentous structures still formed at the plasma membrane, but M assembly during the ensuing elongation process seemed to be impaired, resulting in shorter and more branched filaments as observed using EM. Our data thus imply for the first time that M oligomerization, regulated by negative charge at Thr205, may be critical to production of infectious RSV.

    IMPORTANCE We show here for the first time that RSV Mrrsquo;s role in virus assembly/release is strongly dependent on threonine (Thr205), a consensus site for CK2, which appears to play a key regulatory role in modulating M oligomerization and association with virus filaments. Our analysis indicates that T205 mutations do not impair M dimerization or virus-like filament formation per se, but rather the ability of M to assemble in ordered fashion on the viral filaments themselves. This appears to impact in turn upon the infectivity of released virus, rather than on virus production or release itself. Thus, M oligomerization would appear to be a target of interest for the development of anti-RSV agents; further, the recombinant T205-substituted mutant viruses described here would appear to be the first RSV mutants affected in viral maturation to our knowledge, and hence of considerable interest for vaccine approaches in the future.

  • A unique N-terminal Sequence in the Carnation Italian Ringspot Virus p36 Replicase-Associated Protein Interacts with the Host-Cell ESCRT-I Component Vps23 [PublishAheadOfPrint]

  • Like most positive-strand RNA viruses, infection by plant tombusviruses results in extensive rearrangement of specific host-cell organelle membranes that serve as the sites of viral replication. The tombusvirus Tomato bushy stunt virus (TBSV) replicates within spherules derived from the peroxisomal boundary membrane, a process that involves the coordinated action of various viral and cellular factors, including constituents of the endosomal sorting complex required for transport (ESCRT). ESCRT is comprised of a series of protein sub-complexes (i.e., ESCRT-0 -I, -II and -III) that normally participate in late endosome biogenesis and some of which are also hijacked by certain enveloped retroviruses (e.g., HIV) for viral budding from the plasma membrane. Here we show that the replication of Carnation Italian ringspot virus (CIRV), a tombusvirus that replicates at mitochondrial membranes also relies on ESCRT. In plant cells, CIRV recruits the ESCRT-I protein, Vps23, to mitochondria through an interaction that involves a unique region in the N terminus of the p36 replicase-associated protein that is not conserved in TBSV or other peroxisome-targeted tombusviruses. The interaction between p36 and Vps23 also involves the Vps23 C-terminal steadiness box domain and not its N-terminal ubiquitin E2 variant domain, which in the case of TBSV (and enveloped retroviruses) mediates the interaction with ESCRT. Overall, these results provide evidence that CIRV uses a unique N-terminal sequence for the recruitment of Vps23 that is distinct from those used by TBSV and certain mammalian viruses for ESCRT recruitment. Characterization of this novel interaction with Vps23 contributes to our understanding of how CIRV may have evolved to exploit key differences in the plant ESCRT machinery.

    IMPORTANCE Positive-strand RNA viruses replicate their genomes in association with specific host-cell membranes. To accomplish this, cellular components responsible for membrane biogenesis and modeling are appropriated by viral proteins and redirected to assemble membrane-bound viral replicase complexes. The diverse pathways leading to the formation of these replication structures are poorly understood. We have determined that the cellular ESCRT system that is normally responsible for mediating late endosome biogenesis is also involved in the replication of the tombusvirus Carnation Italian ringspot virus (CIRV) at mitochondria. Notably, CIRV recruits ESCRT to the mitochondrial outer membrane via an interaction between a unique motif in the viral protein p36 and the ESCRT component Vps23. Our findings provide new insights to tombusvirus replication and the virus-induced remodeling of plant intracellular membranes, as well as normal ESCRT assembly in plants.

  • Comparative complete genome analysis of chicken and turkey megriviruses (family Picornaviridae): long 3' untranslated regions with a potential second open reading frame and evidence for possible recombination [PublishAheadOfPrint]

  • Members of the family Picornaviridae consist of small +ssRNA viruses capable of infecting various vertebrate species including birds. One of the recently identified avian picornaviruses, with a remarkably long (ggt;9,040) but still incompletely sequenced genome, is turkey hepatitis virus 1 (THV-1; species Melegrivirus A, genus Megrivirus), a virus associated with liver necrosis and enteritis in commercial turkeys (Meleagris gallopavo). This study reports the genetic analysis of three complete genomes of megriviruses from faecal samples of chickens (chicken/B21-CHV/2012/HUN, KF961186 and chicken/CHK-IV-CHV/2013/HUN, KF961187) (Gallus gallus domesticus) and turkey (turkey/B407-THV/2011/HUN, KF961188) (Meleagris gallopavo) with the largest picornavirus genome (up to 9739 nucleotides) so far described. The close phylogenetic relationship to THV-1 in the non-structural protein-coding genome region and possession of the same internal ribosomal entry site type (IVB-like) suggest that the study strains belong to the genus Megrivirus. However, the genome comparisons revealed numerous unique variations (e.g. different number of potential 2A peptides, unusually long 3rrsquo; genome parts with various lengths of a potential second open reading frame, multiple repeating sequence motifs in the 3rrsquo; untranslated region) and heterogeneous sequence relationships between the structural and non-structural genome regions. These differences suggest the classification of chicken megri-like viruses into a candidate novel species in the genus Megrivirus. Based on the different phylogenetic position of chicken megrivirus-like viruses at the structural and non-structural genome regions, the recombinant nature of these viruses is plausible.

    Importance section: The comparative genome analysis of turkey and novel chicken megriviruses revealed numerous unique genome features e.g. up to four potential 2A peptides, unusually long 3rrsquo; genome parts with various lengths, containing a potential second open reading frame, multiple repeating sequence motifs and heterogeneous sequence relationships (possibly due to a recombination event) between the structural and non-structural genome regions. Our results could help us to better understanding the evolution and diversity (in terms of sequence and genome layout) of picornaviruses.

  • Human Metapneumovirus SH and G Glycoproteins Inhibit Macropinocytosis-Mediated Entry into Human Dendritic Cells and Reduce CD4+ T Cell Activation [PublishAheadOfPrint]

  • Human metapneumovirus (HMPV) is a major etiologic agent of respiratory disease worldwide. HMPV reinfections are common in healthy adults and children, suggesting that the protective immune response to HMPV is incomplete and short-lived. We used gene-deletion viruses to evaluate the role of the attachment G and small hydrophobic SH glycoproteins on virus uptake by primary human monocyte-derived dendritic cells (MDDC) in vitro, and on subsequent MDDC maturation and activation of autologous T cells. HMPV with deletion of G and SH (SHG) exhibited increased infectivity but had little effect on MDDC maturation. However, MDDC stimulated with SHG induced increased proliferation of autologous Th1-polarized CD4+ T cells. This effect was independent of virus replication. Increased T cell proliferation was strictly dependent on contact between virus-stimulated MDDC and CD4+ T cells. Confocal microscopy revealed that deletion of SH and G was associated with an increased number of immunological synapses between memory CD4+ T cells and virus-stimulated MDDC. Uptake of HMPV by MDDC was found to be primarily by macropinocytosis. Uptake of wild-type (WT) virus was reduced compared to SHG, indicative of inhibition by the SH and G glycoproteins. In addition, DC-SIGN-mediated endocytosis provided a minor alternative pathway that depended on SH and/or G and thus operated only for WT. Altogether our results show that SH and G glycoproteins reduce the ability of HMPV to be internalized by MDDC, resulting in a reduced ability of the HMPV-stimulated MDDC to activate CD4+ T cells. This study describes a previously unknown mechanism of virus immune evasion.

    IMPORTANCE Human metapneumovirus (HMPV) is a major etiologic agent of respiratory disease worldwide. HMPV reinfections are common in healthy adults and children, suggesting that the protective immune response to HMPV is incomplete and short-lived. We found that HMPV attachment G and small hydrophobic SH glycoproteins reduce the ability of HMPV to be internalized by macropinocytosis into human dendritic cells (DC). This results in a reduced ability of the HMPV-stimulated DC to activate Th1-polarized CD4+ T cells. These results contribute to a better understanding of the nature of incomplete protection against this important human respiratory virus, provide new information on the entry of HMPV into human cells, and describe a new mechanism of virus immune evasion.

  • Enterovirus 68 3C Protease Cleaves TRIF to Attenuate Antiviral Responses Mediated by Toll-Like Receptor 3 [PublishAheadOfPrint]

  • Human enterovirus (EV) 68 is a member of EV-D species which belongs to the EV genus of the Picornaviridae family. Over the past several years, there have been increasingly documented outbreaks in respiratory disease associated with EV68. As a globally emerging pathogen, EV68 infects both adults and children. However, the molecular basis of EV68 pathogenesis is unknown. Here, we report that EV68 inhibits Toll-like receptor 3 (TLR3)-mediated innate immune response by targeting TIR domain-containing adaptor inducing beta interferon (TRIF). In infected HeLa cells, EV68 inhibits poly(I:C)-induced interferon regulatory factor 3 (IRF3) activation and the interferon-bbeta; (IFN-bbeta;) expression. Further investigations reveal that TRIF, a critical adaptor downstream of TLR3, is targeted by EV68. When expressed alone, 3Cpro, an EV68-encoded protease, cleaves TRIF. 3Cpro mediates TRIF cleavage at Q312 and Q653, two sites in the amino- and carboxyl-terminal domains, respectively. This cleavage relies on its cysteine protease activity. Cleavage of TRIF abolishes the capacity of TRIF to activate NF-B and IFN-bbeta; signaling. These results suggest that control of TRIF by 3Cpro may be a mechanism by which EV68 subverts host innate immune response.

    Importance EV 68 is a globally emerging pathogen, but the molecular basis of EV68 pathogenesis is unclear. Here, we report that EV68 inhibits TLR3-mediated innate immune response by targeting TRIF. Further investigations reveal that TRIF is cleaved by 3Cpro. These results suggest that control of TRIF by 3Cpro may be a mechanism by which EV68 impairs type I IFN production in response to TLR3 activation.

  • The HMPV small hydrophobic protein has properties consistent with a viroporin and can modulate viral fusogenic activity [PublishAheadOfPrint]

  • Human metapneumovirus (HMPV) encodes three glycoproteins: the G protein, which plays a role in glycosaminoglycan binding, the fusion (F) protein, which is necessary and sufficient for both viral binding to the target cell and fusion between the cellular plasma membrane and the viral membrane, and the SH (small hydrophobic) protein, whose function is unclear. The SH protein of the closely related respiratory syncytial virus has been suggested to function as a viroporin, as it forms oligomeric structures consistent with a pore and alters membrane permeability. Our analysis indicates that both the full-length HMPV SH protein and the isolated SH protein transmembrane domain can associate into higher order oligomers. In addition, HMPV SH expression resulted in increases in permeability to hygromycin B and alteration of subcellular localization of a fluorescent dye, indicating that SH affects membrane permeability. These results suggest that the HMPV SH protein has several characteristics consistent with a putative viroporin. Interestingly, we also report that expression of the HMPV SH protein can significantly decrease HMPV F protein-promoted membrane fusion activity, with the SH extracellular domain and transmembrane domain playing the key role in this inhibition. These results suggest that the HMPV SH protein could regulate both membrane permeability and fusion protein function during viral infection.

    IMPORTANCE Human metapneumovirus (HMPV), first identified in 2001, is a causative agent of severe respiratory tract disease worldwide. The small hydrophobic (SH) protein is one of three glycoproteins encoded by all strains of HMPV, but the function of the HMPV SH protein is unknown. We have determined that the HMPV SH protein can alter the permeability of cellular membranes, suggesting that HMPV SH is a member of a class of proteins termed viroporins, which modulate membrane permeability to facilitate critical steps in a viral life cycle. We also demonstrated that HMPV SH can inhibit the membrane fusion function of the HMPV fusion protein. This work suggests that the HMPV SH protein has several functions, though the steps in the HMPV life cycle impacted by these functions remain to be clarified.

  • Identification of a novel rhabdovirus in Spodoptera frugiperda cell lines [PublishAheadOfPrint]

  • Sf9 cell line, derived from Spodoptera frugiperda, is used as a cell substrate for biological products and no viruses have been reported after extensive testing. We have used degenerate PCR assays and massively parallel sequencing (MPS) to identify a novel RNA virus belonging to the order Mononegavirales in Sf9 cells. Sequence analysis of the assembled virus genome showed the presence of five ORFs corresponding to the N, P, M, G, and L genes in other rhabdoviruses, and an unknown ORF of 111 amino acids located between G and L. BLAST searches indicated that Sf-rhabdovirus was related in a limited region of the L protein gene to Taastrup virus, a newly discovered member of Mononegavirales from a leafhopper (Hemiptera), and also to plant rhabdoviruses, particularly in the genus Cytorhabdovirus. Phylogenetic analysis of sequences in the L protein gene indicated that Sf-rhabdovirus was a novel virus that branched with Taastrup virus. Rhabdovirus morphology was confirmed by transmission electron microscopy of filtered supernatant samples from Sf9 cells. Infectivity studies indicated potential transient infection by Sf-rhabdovirus in other insect cell lines, but there was no evidence of entry or virus replication in human cell lines. Sf-rhabdovirus sequences were also found in the Sf9 parental cell line, Sf21, but not in other insect cell lines such as BT1-TN-5B1-4 (Tn5; High Fivettrade;) and Schneiderrrsquo;s Drosophila Line 2 [D. Mel (2)., SL2], indicating a species-specific infection. The results indicate that conventional methods may be complemented by state-of-the art technologies with extensive bioinformatics analysis for identification of novel viruses.

    IMPORTANCE The Spodoptera frugiperda Sf9 cell line is used as a cell substrate for the development and manufacture of biological products. Extensive testing has not previously identified any viruses in this cell line. This paper reports the identification and characterization of a novel rhabdovirus in Sf9 cells. This was accomplished through the use of next-generation sequencing platforms, de novo assembly tools, and extensive bioinformatics analysis. Rhabdovirus identification was further confirmed by transmission electron microscopy. Infectivity studies showed lack of replication of Sf-rhabdovirus in human cell lines. The overall study highlights the use of a combinatorial testing approach including conventional methods and new technologies for evaluation of cell lines for unexpected viruses and use of comprehensive bioinformatics strategies for obtaining confident next-generation sequencing results.

  • Impairment of HIV-1 cDNA Synthesis by DBR1 Knockdown [PublishAheadOfPrint]

  • Previous studies showed that shRNA knockdown of the RNA lariat debranching enzyme (DBR1) led to a decrease in the production of HIV-1 cDNA. To further characterize this effect, DBR1 shRNA was introduced into GHOST-R5X4 cells followed by infection at a multiplicity near unity with HIV-1 or an HIV-1 derived vector. DNA and RNA were isolated from whole cells and from cytoplasmic and nuclear fractions at different times post-infection. Inhibition of DBR1 had little or no effect on formation of minus-strand strong-stop cDNA, but caused a significant reduction in intermediate and full-length cDNA. Moreover, minus-strand strong-stop DNA rapidly accumulated in the cytoplasm in the first two hours of infection but shifted to the nuclear fraction by six hours post infection. Regardless of DBR1 inhibition, greater than 95% of intermediate-length and full-length HIV-1 cDNA was found in the nuclear fraction at all time points. Thus in these experimental conditions, HIV-1 cDNA synthesis was initiated in the cytoplasm and completed in the nucleus or perinuclear region of the infected cell. When nuclear import of the HIV-1 reverse transcription complex was blocked by expressing a truncated form of the mRNA cleavage and polyadenylation factor, CPSF6, completion of HIV-1 vector cDNA synthesis was detected in the cytoplasm, where it was not inhibited by DBR1 knockdown. Refinement of the cell fractionation procedure indicated that completion of reverse transcription occurred both within nuclei and in the perinuclear region. Taken together the results indicate that in infections at a multiplicity near one, HIV-1 reverse transcription is completed in the nucleus or perinuclear region of the infected cell where it is dependent on DBR1. When nuclear transport is inhibited, reverse transcription is completed in the cytoplasm in a DBR1 independent manner. Thus there are at least two mechanisms of HIV-1 reverse transcription that require different factors and occur in different intracellular locations.

    IMPORTANCE This study shows that HIV-1 reverse transcriprtion starts in the cytoplasm but is completed in or on the surface of the nucleus. Moreover, we show that nuclear reverse transcription is dependent on activity of the human RNA lariat debranchng enzyme, DBR1, while cytoplasmic reverse transcription is not. These findings may provide new avenues for inhibiting HIV-1 replication and therfore may lead to new medicines for treating HIV-1 infected individuals.

  • Coregulatory Interactions between CD8{alpha} DCs, LAT, and PD-1 Contribute to higher HSV-1 Latency [PublishAheadOfPrint]

  • The latency-associated transcript (LAT) of HSV-1, CD8aalpha;+ dendritic cells (DCs), and programmed death-1 (PD-1) have all been implicated in the HSV-1 latency-reactivation cycle. It is not known, however, whether an interaction between LAT and CD8aalpha;+ DCs regulates latency and T-cell exhaustion. To address this question, we used LAT(+) and LAT(-)viruses. Depletion of DCs in mice ocularly infected with LAT(+) virus resulted in a reduction in the number of T cells expressing PD-1 in the trigeminal ganglia (TG), whereas depletion of DCs in mice similarly infected with LAT(-) virus did not alter PD-1 expression. CD8aalpha;+ DCs, but not CD4+ DCs, infected with LAT(+) virus had higher levels of ICP-0, ICP-4, TK, and PD-L1 transcripts than those infected with LAT(-) virus. Coculture of infected bone marrow (BM) derived DCs from wild-type (WT) mice, but not infected DCs from CD8aalpha;-/- mice, with WT naive T cells contributed to an increase in PD-1 expression. Transfer of bone marrow from WT mice, but not from CD8aalpha;-/- mice, to recipient Rag1-/- mice increased the number of latent viral genomes in reconstituted mice infected with the LAT(+) virus. Collectively, this data indicated that a reduction in latency correlated with a decline in the levels of CD8aalpha;+ DCs and PD-1 expression. In summary, our results demonstrate an interaction among LAT, PD-1, and CD11cCD8aalpha;+ cells that regulates latency in the TG of HSV-1 infected mice.

    Importance Very little is known regarding the inter-relationship of LAT, PD-1, and CD8aalpha;+ DCs, and how such interactions might contribute to relative number of latent viral genomes. We have shown here that: (1) In both in vivo and in vitro studies, deficiency of CD8aalpha;+ DCs significantly reduced T-cell exhaustion in the presence of LAT(+) virus but not LAT(-) virus; (2) HSV-1 infectivity was significantly lower in the LAT(-)-infected DCs than their LAT(+)-infected counterparts; and (3) Adoptive transfer of bone marrow (BM) from WT but not CD8aalpha;-/- mice to recipient Rag1-/- mice restored latency to the WT mice level following infection with LAT(+) virus.

    These studies point to a key role for CD8aalpha;+ DCs in T-cell exhaustion in the presence of LAT, which leads to higher numbers of latent viral genomes. Thus, altering this negative function of CD8aalpha;+ DCs can potentially be used to generate a more effective vaccine against HSV infection.

  • The Rhinovirus Subviral A-Particle Exposes 3'-terminal Sequences of its Genomic RNA [PublishAheadOfPrint]

  • Enteroviruses, a large genus within the family Picornaviridae, undergo important conformational modifications during infection of the host cell. Once internalized by receptor-mediated endocytosis, receptor binding and/or the acidic endosomal environment triggers the native virion to expand and convert into the subviral (altered) A-particle. The A-particle is lacking the internal capsid protein VP4 and exposes N terminal amphipathic sequences of VP1, allowing for its direct interaction with a lipid bilayer. The genomic ss(+)RNA then exits through a hole close to a 2-fold axis of icosahedral symmetry and passes through a pore in the endosomal membrane into the cytosol, leaving behind the empty shell. We demonstrate that in vitro acidification of a prototype of the minor receptor group of common cold viruses, human rhinovirus A2 (HRV-A2), additionally results in egress of the poly-(A) tail of the RNA from the A-particle, along with some 700 adjacent nucleotides. However, even after hours of incubation at pH 5.2, 5'-proximal sequences remain inside the capsid. By contrast, the entire RNA genome is released within minutes of exposure to the acidic endosomal environment in vivo. This finding suggests that the exposed 3'-poly-(A) tail facilitates the positioning of the RNA exit site onto the putative channel in the lipid bilayer, thereby preventing the egress of viral RNA into the endosomal lumen, where it may be degraded.

    IMPORTANCE For host cell infection, a virus transfers its genome from within the protective capsid into the cytosol; this requires modifications of the viral shell. In common cold viruses, exit of the RNA genome is prepared by the acidic environment in endosomes converting the native virion into the subviral A-particle. We demonstrate that acidification in vitro results in RNA exit starting from the 3'-terminal poly-(A). However, the process halts as soon as about 700 bases have left the viral shell. Conversely, inside the cell, RNA egress completes in about 2 min. This suggests the existence of cellular uncoating facilitators.

  • The Rad6/18 Ubiquitin Complex Interacts with the Epstein-Barr Virus Deubiquitinating Enzyme, BPLF1, and Contributes to Virus Infectivity [PublishAheadOfPrint]

  • Epstein-Barr Virus encodes BPLF1, a lytic cycle protein with deubiquitinating activity that is contained in its N-terminal domain and conserved across Herpesviridae. EBV replication is associated with cellular DNA replication and repair factors, and initiation of EBV lytic replication induces a DNA damage response, which at least in part can be regulated by BPLF1. The cellular DNA repair pathway, Trans-lesion synthesis (TLS), is disrupted by BPLF1 which deubiquitinates the DNA processivity factor, PCNA, and inhibits the recruitment of the TLS polymerase, pol eta, after damage to DNA by UV irradiation. Here we show that the E3 ubiquitin ligase, which activates TLS repair by monoubiquitination of PCNA, is also affected by BPLF1 deubiquitinating activity. First, BPLF1 interacts directly with Rad18, and over-expression of BPLF1 results in increased levels of Rad18 protein suggesting that it stabilizes Rad18. Next, expression of functionally active BPLF1 caused relocalization of Rad18 into nuclear foci which is consistent with sites of cellular DNA replication that occur during S-phase. Also, levels of Rad18 remain constant during lytic reactivation of wild-type virus, but reactivation of BPLF1 knockout virus resulted in decreased levels of Rad18. Finally, the contribution of Rad18 levels to infectious virus production was examined with siRNA targeting Rad18. Results demonstrated that reducing levels of Rad18 decreased production of infectious virus, and infectious titers of BPLF1 knockout virus were partially restored by overexpression of Rad18. Thus BPLF1 interacts with and maintains Rad18 at high levels during lytic replication which assists in production of infectious virus.

    Importance: Characterization of EBV BPLF1rrsquo;s deubiquitinating activity, identification of its targets and subsequent functional effects remain little studied. All members of the Herpesviridae contain BPLF1 homologs with conserved enzymatic activity, and findings discovered with EBV BPLF1 are likely applicable to other members of the family. Discovery of new targets of BPLF1 will point to cellular pathways and viral processes regulated by the enzymatic activity of the EBV-encoded deubiquitinating enzyme. Here we determine the importance of the cellular ubiquitin ligase, Rad18, in these processes and how it is affected by BPLF1. Our findings demonstrate that EBV can co-opt Rad18 as a novel accessory factor in the production of infectious virus.

  • Substitution of herpes simplex virus 1 entry glycoproteins with those of saimiriine herpesvirus 1 reveals a gD-gH/gL functional interaction and a region within the gD profusion domain that is critical for fusion [PublishAheadOfPrint]

  • To gain insight into the mechanism of herpesvirus entry into cells, the four glycoproteins that are necessary for herpes simplex virus (HSV) fusion were cloned from the saimiriine herpesvirus 1 (SaHV-1) genome, a primate member of the alphaherpesvirus family. Cell-cell fusion assays indicate SaHV-1 entry glycoproteins function with the previously identified alphaherpesvirus entry receptors nectin-1 and CD155, but not with HVEM or PILRaalpha;. Replacement of HSV-1 gD with the SaHV-1 gD homolog resulted in a complete loss of fusion function when coexpressed with HSV-1 gB and gH/gL. HSV-1 gD was also unable to substitute for SaHV-1 gD when coexpressed with SaHV-1 gB and gH/gL. Similarly, the gH/gL heterodimers from HSV-1 and SaHV-1 were not interchangeable. In contrast, both the HSV-1 and SaHV-1 gB homologs retained function in a heterotypic context. These results suggest that an essential interaction between homotypic gD and gH/gL occurs during both HSV-1 and SaHV-1 entry. To map the site of this homotypic interaction, we created a series of gD chimeras, focusing on the "profusion domain" (PFD) that consists of HSV-1 gD residues 261-305 or SaHV-1 gD residues 264-307. We identified a seven amino acid stretch (264 RTLPPPK 270) at the N-terminus of the SaHV-1 gD PFD that contributes to homotypic fusion. Finally, we found that the gD receptor binding region and PFD cannot function independently, but both can inhibit the function of wild-type gD.

    IMPORTANCE The herpesvirus entry machinery requires the concerted action of at least four glycoproteins, however details of the interactions among these glycoproteins are not well understood. Like HSV-1, SaHV-1 belongs to the alphaherpesvirus subfamily. Using cell-cell fusion experiments, we found that SaHV-1 uses the entry receptors nectin-1 and CD155, but not HVEM or PILRaalpha;. By attempting to swap the entry glycoproteins between HSV-1 and SaHV-1, we revealed a functional interaction between gD and gH/gL. To examine the homotypic interaction site on gD, we evaluated the function of a panel of HSV-1/SaHV-1 gD chimeras and identified a small region in the SaHV-1 gD profusion domain that is critical for SaHV-1 fusion. This study contributes to our understanding of the molecular mechanisms of herpesvirus entry and membrane fusion.

  • Animal model of respiratory syncytial virus: CD8+ T cells cause cytokine storm that is chemically tractable by sphingosine-1-phosphate 1 receptor agonist therapy [PublishAheadOfPrint]

  • Cytokine storm is an intensified, dysregulated, tissue injurious inflammatory response driven by cytokine and immune cell components. Cytokine storm has been well characterized during influenza virus infection whereby the amplified innate immune response is primarily responsible for pulmonary damage. Now we describe a novel event where virus-specific T cells induce cytokine storm. The paramyxovirus, pneumonia virus of mice (PVM), is a model of human respiratory syncytial virus (hRSV). Unexpectedly, when C57Bl/6 mice were infected with PVM the innate inflammatory response was undetectable until day 5 post-infection, at which time CD8+ T cells infiltrated into the lung initiating cytokine storm by their production of IFN- and TNF-aalpha;. Administration of an immunomodulatory sphingosine-1-phosphate (S1P) receptor 1 (S1P1R) agonist significantly inhibited PVM-elicited cytokine storm by blunting the PVM-specific CD8+ T cell response resulting in diminished pulmonary disease and enhanced survival.

    Importance section Dysregulated overly exuberant immune response termed "cytokine storm" accompanies virus-induced acute respiratory diseases (VARV), is primarily responsible for the accompanying high morbidity and mortality and can be controlled therapeutically in influenza virus infection of mice and ferrets by administration of sphingosine-1-phosphate 1 receptor (S1P1R) agonists. Here two novel findings are recorded. First, in contrast to influenza infection where cytokine storm is initiated early by the innate immune system, for pneumonia virus of mice (PVM), a model of RSV, cytokine storm is initiated late in infection by the adoptive immune response specifically by virus-specific CD8 T cells via their release of interferon- and TNF-aalpha;. Blockading these cytokines with neutralizing antibodies blunts cytokine storm and protects the host. Second, PVM infection is controlled by administration of S1P1R agonist.

  • NTPDASE4 gene products cooperate with the adenovirus E4orf4 protein through PP2A-dependent and --independent mechanisms and contribute to induction of cell death [PublishAheadOfPrint]

  • The adenovirus E4orf4 protein induces non-classical apoptosis in mammalian cells through at least two complementing pathways regulated by the interactions of E4orf4 with protein phosphatase 2A (PP2A) and Src kinases. In yeast cells, which do not express Src, E4orf4 induces PP2A-dependent toxicity. The yeast Golgi apyrase Ynd1 was found to contribute to E4orf4-mediated toxicity and to interact with the PP2A-B55aalpha; regulatory subunit. In addition, a mammalian Ynd1 orthologue, the NTPDASE4 gene product Golgi UDPase, was shown to physically interact with E4orf4. Here we report that knockdown of NTPDASE4 suppressed E4orf4-induced cell-death. Conversely, overexpression of the NTPDASE4 gene products Golgi UDPase and LALP70 enhanced E4orf4-induced cell-killing. We found that similarly to results obtained in yeast, the apyrase activity of mammalian UDPase was not required for its contribution to E4orf4-induced toxicity. The interaction between E4orf4 and UDPase had two consequences; one that was PP2A-dependent, resulted in increased UDPase levels, and a PP2A-independent outcome that led to dissociation of large UDPase-containing protein complexes. The present report extends our findings in yeast to E4orf4-mediated death of mammalian cells, and combined with previous results it suggests that the E4orf4-NTPDase4 pathway, partly in association with PP2A, may provide an alternative mechanism for the E4orf4-Src pathway to contribute to the cytoplasmic death function of E4orf4.

    IMPORTANCE The adenovirus E4orf4 protein contributes to regulation of the progression of virus infection from the early to the late phase and when expressed alone it induces a unique caspase-independent programmed cell death which is more efficient in cancer cells than in normal cells. The interactions of E4orf4 with cellular proteins that mediate its functions, such as PP2A and Src kinases, are highly conserved in evolution. The results presented here reveal that the NTPDASE4 gene product Golgi UDPase, first discovered to contribute to E4orf4 toxicity in yeast, associates with E4orf4 and plays a role in induction of cell death in mammalian cells. Details of the functional interaction between E4orf4, PP2A and the UDPase are described. Identification of the evolutionarily-conserved mechanisms underlying E4orf4 activity will increase our understanding of the interactions between the virus and the host cell and will contribute to our understanding of the unique mode of E4orf4-induced cell death.

  • The Tripartite Virions of the Brome Mosaic Virus Have Distinct Physical Properties that Affect the Timing of the Infection Process [PublishAheadOfPrint]

  • The three subsets of virions that comprise the Brome mosaic virus (BMV) were previously thought to be indistinguishable. This work tests the hypothesis that distinct capsid-RNA interactions in the BMV virions will allow different rates of viral RNA release. Several results support distinct interactions between the capsid and the BMV genomic RNAs. First, the deletion of the first eight residues of the BMV coat protein (CP) resulted in the RNA1-containing particles having altered morphologies while those containing RNA2 were unaffected. Second, subsets of the BMV particles separated by density gradients into a pool enriched for RNA1 (B1) and for RNA2 and RNA3/4 (B2.3/4), were found to have different physiochemical properties. When compared to the B2.3/4 particles, the B1 particles were more sensitive to protease digestion, had greater resistivity to nanoindentation by atomic force microscopy and increased susceptibility to nuclease digestion. Mapping studies showed that portions of the arginine-rich N-terminal tail of the CP could interact with RNA1. Mutational analysis in the putative RNA1-contacting residues severely reduced encapsidation of BMV RNA1 without affecting the encapsidation of RNA2. Finally, during infection of plants, the more easily released RNA1 accumulated to higher levels early in the infection.

    IMPORTANCE Viruses with genomes packaged in distinct virions could theoretically release the genomes at different times to regulate the timing of gene expression. Using an RNA virus composed of three particles, we demonstrate that the RNA in one of the virions is released more easily than the other two in vitro. The differential RNA release is due to distinct interactions between the viral capsid protein and the RNAs. The ease of RNA release is also correlated with the more rapid accumulation of that RNA in infected plants. Our study identified a novel role for capsid-RNA interactions in the regulation of a viral infection.

  • High vector competence of Aedes aegypti and Aedes albopictus from ten American countries as a crucial factor of the spread of Chikungunya [PublishAheadOfPrint]

  • Chikungunya virus (CHIKV) causes a major public health problem. In 2004, CHIKV began an unprecedented global expansion and has been responsible for epidemics in Africa, Asia, islands in the Indian Ocean region, and surprisingly, in temperate regions such as Europe. Intriguingly, no local transmission of chikungunya virus (CHIKV) has been reported in the Americas until recently despite the presence of vectors and annually-reported imported cases. Here, we assessed the vector competence of 35 American Ae. aegypti and Ae. albopictus populations to three CHIKV genotypes. We also compared the number of viral particles of different CHIKV strains in mosquito saliva at two different times post-infection. Primarily, viral dissemination rates were high for all mosquito populations irrespective of the tested CHIKV isolate. In contrast, differences in transmission efficiency (TE) were underlined in populations of both species through the Americas suggesting the role of salivary glands in selecting CHIKV for highly efficient transmission. Nonetheless, both mosquito species were capable to transmit all three CHIKV genotypes, and TE reached alarming rates as high as 83.3% and 96.7% in Ae. aegypti and Ae. albopictus populations, respectively. Ae. albopictus better transmitted the epidemic mutant strain CHIKV_0621 of the East-Central-South African (ECSA) genotype than did Ae. aegypti, whereas this latter species was more capable of transmitting the original ECSA CHIKV_115 strain and also the Asian genotype CHIKV_NC. Therefore, a high risk of establishment and spread of CHIKV throughout the tropical, subtropical and even temperate regions of the Americas is more real than ever.

    IMPORTANCE Until recently, the Americas have never reported chikungunya (CHIK) autochthonous transmission despite its global expansion beginning in 2004. Large regions of the continent are highly infested with Ae. aegypti and Ae. albopictus and millions of dengue (DEN) cases are annually recorded. Indeed, DEN and CHIK viruses share the same vectors. Due to a recent CHIK outbreak affecting Caribbean islands, the need for a Pan-American evaluation of vector competence was compelling as a key parameter in assessing the epidemic risk. We demonstrated for the first time that Ae. aegypti and Ae. albopictus populations throughout the continent are highly competent to transmit CHIK irrespective to the viral genotypes tested. The risk of CHIK spreading throughout the tropical, subtropical and even temperate regions of the Americas is more than ever a reality. In light of our results, local authorities should immediately pursue and reinforce epidemiological and entomological surveillance to avoid a severe epidemic.

  • An allometric relationship between the genome length and virion volume of viruses [PublishAheadOfPrint]

  • Virions vary in size by at least four orders of magnitude, yet the evolutionary forces responsible for this enormous diversity are unknown. We document a significant allometric relationship, with an exponent of approximately 1.5, between the genome length and virion volume of viruses and find that this relationship is not due to geometric constraints. Notably, this allometric relationship holds regardless of genomic nucleic acid, genome structure, or type of virion architecture, and therefore represents a powerful scaling law. In contrast, no such relationship is observed at the scale of individual genes. Similarly, after adjusting for genome length, no association is observed between virion volume and the number of proteins, ruling out protein number as the explanation for the relationship between genome and virion sizes. Such a fundamental allometric relationship not only sheds light on the constraints to virus evolution, in that increases in virion size, but not necessarily structure, are associated with concomitant increases in genome size, but implies that virion sizes in nature can be broadly predicted from genome sequence data alone.

    IMPORTANCE Viruses vary dramatically in both genome and virion sizes, but the factors responsible for this diversity are uncertain. Through a comparative and quantitative investigation of these two fundamental biological parameters across diverse viral taxa we show that genome length and virion volume conform to a simple allometric scaling law. Notably, this allometric relationship holds regardless of the type of virus, including those with both RNA and DNA genomes, and encompasses viruses that exhibit more than three logs of genome size variation. Accordingly, this study helps to reveal the basic rules of virus design.

  • Human Metapneumovirus Virus-like Particles Induce Protective B and T cell Responses in a Mouse Model [PublishAheadOfPrint]

  • HMPV is a leading cause of respiratory disease in infants, children, and the elderly worldwide, yet no licensed vaccines exist. Live-attenuated vaccines present safety challenges and protein subunit vaccines induce primarily antibody responses. Virus-like particles (VLPs) are an attractive alternative vaccine approach due to reduced safety concerns compared with live vaccines. We generated HMPV VLPs by expressing viral proteins in suspension-adapted human embryonic kidney epithelial (293-F) cells and found that the viral matrix (M) and fusion (F) proteins were sufficient to form VLPs. We previously reported that the VLPs resemble virus morphology and incorporate fusion-competent F protein (R.G. Cox et al., J. Virol. 86:12148-12160, 2012), which we hypothesized would elicit F-specific antibody and T cell responses. In this study, we tested whether VLP immunization could induce protective immunity to HMPV using a mouse model. C57BL/6 mice were injected twice intraperitoneally with VLPs alone or with adjuvant and subsequently challenged with HMPV. Mice were euthanized 5 days post infection, and virus titers, levels of neutralizing antibodies, and numbers of CD3+ T cells were quantified. Mice immunized with VLPs mounted an F-specific antibody response, and generated CD8+ T cells recognizing an F-protein derived epitope. VLP immunization induced a neutralizing antibody response, which was enhanced by the addition of either TiterMax Gold or aalpha;-galactosylceramide adjuvant. Two doses of VLPs conferred complete protection against HMPV replication in the lungs of mice, and were not associated with a Th2-skewed cytokine response. These results suggest that non-replicating VLPs are a promising vaccine candidate for HMPV.

    IMPORTANCE Human metapneumovirus (HMPV) is a leading cause of acute respiratory infection in infants, children, and the elderly worldwide, yet no licensed vaccines exist. Live-attenuated vaccines present safety challenges and protein subunit vaccines induce primarily antibody responses. Virus-like particles (VLPs) are an attractive alternative vaccine approach. We generated HMPV VLPs by expressing the viral matrix (M) and fusion (F) proteins in mammalian cells. We found that mice immunized with VLPs mounted an F-specific antibody response, and generated CD8+ T cells recognizing an F-protein derived epitope. VLP immunization induced a neutralizing antibody response, which was enhanced by the addition of either TiterMax Gold or aalpha;-galactosylceramide adjuvant. Two doses of VLPs conferred complete protection against HMPV replication in the lungs of mice, and were not associated with a Th2-skewed cytokine response. These results suggest that non-replicating VLPs are a promising vaccine candidate for HMPV.

  • Lysophosphatidylcholine Reversibly Arrests Pore Expansion During Syncytium Formation Mediated by Diverse Viral Fusogens [PublishAheadOfPrint]

  • Using lysophosphatidylcholine, a curvature-inducing lysolipid, we have isolated a reversible, "stalled pore" phenotype during syncytium formation induced by the p14 fusion-associated small transmembrane (FAST) protein and influenza virus HA fusogens. This is the first evidence that lateral propagation of stable fusion pores leading to syncytiogenesis mediated by diverse viral fusogens is inhibited by promotion of positive membrane curvature in the outer leaflets of the lipid bilayer surrounding intercellular fusion pores.

  • Activation of Kaposi's sarcoma-associated herpesvirus by inhibitors of class III histone deacetylases: identification of SIRT1 as a regulator of KSHV life cycle [PublishAheadOfPrint]

  • Kaposi's sarcoma-associated herpesvirus (KSHV) establishes persistent latent infection in immunocompetent hosts. Disruption of KSHV latency results in viral lytic replication, which promotes the development of KSHV-related malignancies in immunocompromised individuals. While inhibitors of classes I and II histone deacetylases (HDACs) potently reactivate KSHV from latency, the role of class III HDACs sirtuins (SIRTs) in KSHV latency remains unclear. Here, we examined the effects of inhibitors of SIRTs nicotinamide (NAM) and sirtinol on KSHV reactivation from latency. Treatment of latent KSHV-infected cells with NAM or sirtinol induced transcripts and proteins of the master lytic transactivator RTA (ORF50), early lytic genes ORF57 and ORF59, and late lytic gene ORF65, and increased the production of infectious virions. NAM increased the acetylation of histones H3 and H4 as well as active histone H3 trimethyl Lys4 (H3K4me3) mark but decreased repressive histone H3 trimethyl Lys27 (H3K27me3) mark in the RTA promoter. Consistent with these results, we detected SIRT1 binding to the RTA promoter. Importantly, knock down of SIRT1 was sufficient to increase the expression of KSHV lytic genes. Accordingly, H3K4me3 mark was increased while H3K27me3 mark was decreased in the RTA promoter following SIRT1 knock down. Furthermore, SIRT1 interacted with RTA and inhibited RTA transactivation of its own promoter and that of downstream target gene vIL-6. These results indicate that SIRT1 regulates KSHV latency by inhibiting different stages of viral lytic replication, and link cellular metabolic state with KSHV life cycle.

    IMPORTANCE Kaposi's sarcoma-associated herpesvirus (KSHV) is the causal agent of several malignancies including Kaposi's sarcoma commonly found in immunocompromised patients. While latent infection is required for the development of KSHV-induced malignancies, viral lytic replication also promotes disease progression. However, the mechanism controlling KSHV latent vs. lytic replication remains unclear. In this study, we have found that class III histone deacetylases (HDACs), also known as SIRTs, whose activities are linked to cellular metabolic state, mediate KSHV replication. Inhibitors of SIRTs can reactivate KSHV from latency. SIRTs mediate KSHV latency by epigenetically silencing a key KSHV lytic replication activator RTA. We found that one of the SIRTs SIRT1 binds to RTA promoter to mediate KSHV latency. Knock down of SIRT1 is sufficient to induce epigenetic remodeling and KSHV lytic replication. SIRT1 also interacts with RTA and inhibits RTA's transactivation function, preventing the expression of its downstream genes. Our results indicate that SIRTs regulate KSHV latency by inhibiting different stages of viral lytic replication, and link cellular metabolic state with KSHV life cycle.

  • A complex comprising PI4KB, ACBD3, and Aichi virus proteins enhances PI4P synthesis and is critical for formation of the viral replication complex [PublishAheadOfPrint]

  • Phosphatidylinositol 4-kinase IIIbbeta; (PI4KB) is a host factor required for the replication of certain picornavirus genomes. We previously showed that the nonstructural proteins, 2B, 2BC, 2C, 3A, and 3AB of the picornavirus Aichi virus (AiV), a picornavirus, interact with the Golgi protein, acyl-coenzyme A binding domain containing 3 (ACBD3), which interacts with PI4KB. These five viral proteins, ACBD3, PI4KB, and the PI4KB product phosphatidylinositol 4-phosphate (PI4P) colocalize to the AiV RNA replication sites (J. Sasaki et al., EMBO J. 31: 754-766, 2012). We here examined the roles of these viral and cellular molecules in the formation of AiV replication complexes. Immunofluorescence microscopy revealed that treatment of AiV polyprotein-expressing cells with a small interfering RNA targeting ACBD3 abolished colocalization of the viral 2B, 2C, and 3A proteins with PI4KB. A PI4KB-specific inhibitor also prevented their colocalization. Virus RNA replication increased the level of cellular PI4P without affecting that of PI4KB, and individual expression of 2B, 2BC, 2C, 3A, or 3AB stimulated PI4P generation. These results suggest that the viral protein/ACBD3/PI4KB complex plays an important role in forming the functional replication complex by enhancing PI4P synthesis. Of the viral proteins, 3A and 3AB were shown to stimulate the in vitro kinase activity of PI4KB through forming a 3A or 3AB/ACBD3/PI4KB complex, whereas the ACBD3-mediated PI4KB activation by 2B and 2C remains to be demonstrated.

    IMPORTANCE The PI 4-kinase PI4KB is a host factor required for the replication of certain picornavirus genomes. Aichi virus, a picornavirus belonging to the genus Kobuvirus, forms a complex comprising one of the viral nonstructural proteins, 2B, 2BC, 2C, 3A, and 3AB, the Golgi protein ACBD3, and PI4KB to synthesize PI4P at the sites for viral RNA replication. However, the roles of this protein complex in forming the replication complex are unknown. This study showed that virus RNA replication and individual viral proteins enhance the level of cellular PI4P, and suggested that the viral protein/ACBD3/PI4KB complex plays an important role in forming a functional replication complex. Thus, the present study provides a new example of modulation of cellular lipid metabolism by viruses to support the replication of their genomes.

  • Cryo-EM study of insect cell-expressed Enterovirus 71 and Coxsackievirus A16 virus-like particles provides a structural basis for vaccine development [PublishAheadOfPrint]

  • Enterovirus 71 (EV71) and Coxsackievirus A16 (CA16) are the two most common etiological agents responsible for the epidemics of hand, foot, and mouth disease (HFMD), a childhood illness with occasional severe neurological complications. A number of vaccine candidates against EV71 or CA16 have been reported, however, no vaccine is currently available for clinical use. Here, we generated a secreted version of EV71 and CA16 virus-like particles (VLPs) using a baculovirus-insect cell expression system, and reconstructed the three-dimensional (3D) structures of both VLPs by cryo-electron microscopy (cryo-EM) single particle analysis at 5.2 AAring; and 5.5 AAring; resolutions, respectively. The reconstruction results showed that the cryo-EM structures of EV71 and CA16 VLPs highly resemble the recently published crystal structures for EV71 natural empty particles and CA16 135S-like expanded particles, respectively. Our cryo-EM analysis also revealed that the majority of previously identified linear neutralizing epitopes are well preserved on the surface of EV71 and CA16 VLPs. In addition, both VLPs were able to induce efficiently neutralizing antibodies against various strains of EV71 and CA16 viruses in mice immunization. These studies provide a structural basis for the development of insect cell-expressed VLP vaccines and for a potential bivalent VLP vaccine against both EV71 and CA16-associated HFMD.

    IMPORTANCE The recent outbreaks of hand, foot, and mouth disease (HFMD) in the Asia Pacific region spurred the search for effective vaccines against EV71 and CA16 viruses, the two most common etiological agents responsible for HFMD. In this manuscript, we showed that a secreted version of EV71 and CA16 VLPs generated in the baculovirus-insect cell expression system highly resemble the crystal structures of their viral conterparts, and the majority of previously identified linear neutralizing epitopes are well preserved on the VLP surfaces. In addition, the generated VLPs can efficiently induce neutralizing antibodies against various strains of EV71 and CA16 viruses in mice immunization. These studies provide a structural basis for the development of insect cell-expressed VLP vaccines and for a potential bivalent VLP vaccine against both EV71 and CA16-associated HFMD.

  • Nuclear magnetic resonance structure revealed that human polyoma JC virus agnoprotein contains an alpha-helix encompassing the Leu/Ile/Phe-rich domain [PublishAheadOfPrint]

  • Agnoprotein is a small multifunctional regulatory protein required for sustaining productive replication cycle of JC Virus (JCV). It is a mostly cytoplasmic protein localizing in the perinuclear area and forms highly stable dimers/oligomers through a Leu/Ile/Phe-rich domain. There have been no 3D structural data available for agnoprotein due to difficulties associated with dynamic conversions from monomers to oligomers. Here, we report the first NMR structure of a synthetic agnoprotein peptide spanning amino acids from Thr17 to Glu55, where Lys23-Phe39 encompassing the Leu/Ile/Phe-rich domain forms an amphipathic aalpha;-helix. Based on these structural data, a number of Ala substitution mutations were made to investigate the role of the aalpha;-helix in structure and function of agnoprotein. Single L29A and L36A mutations exhibited a significant negative effect on both protein stability and viral replication, whereas L32A mutation did not. In addition, the L29A mutant displayed a highly nuclear localization pattern in contrast to the wild type (WT). Interestingly, a triple mutant, L29A+L32A+L36A, yielded no detectable agnoprotein expression and JCV replication for this mutant was significantly reduced suggesting that Leu29 and Leu36 are located at the dimer interface contributing to the structure and stability of agnoprotein. Two other single mutations, L33A and E34A did not perturb the agnoprotein stability as drastically as that is observed for L29A and L36A mutants, but negatively affected the viral replication suggesting that the role of these residues are functional rather than structural. Thus, the agnoprotein dimerization domain can be targeted for novel drug development purposes against JCV infection.

    IMPORTANCE Agnoprotein is a small regulatory protein of JC virus (JCV) and is required for the successful completion of the viral replication cycle. It forms highly stable dimers and oligomers through its hydrophobic domain (Leu/Ile/Phe-rich), which has been shown to play essential roles in the stability and function of the protein. In this work, the Leu/Ile/Phe-rich domain has been further characterized by NMR studies using an agnoprotein peptide spanning amino acids from T17 to Q54, which revealed that the dimerization domain of the protein forms an amphipathic aalpha;-helix. Subsequent NMR structure-based mutational analysis of the region highlighted the critical importance of the certain amino acids within the aalpha;-helix for the stability and function of agnoprotein. In conclusion, this study provides a solid foundation for developing effective therapeutic approaches against the dimerization domain of the protein to inhibit its critical roles in JCV infection.

  • Intestinal epithelial barrier disruption through altered mucosal microRNA expression in HIV and SIV infections [PublishAheadOfPrint]

  • Epithelial barrier dysfunction during HIV infection has largely been attributed to the rapid and severe depletion of CD4 T cells in the gastrointestinal (GI) tract. Although it is known that changes in mucosal gene expression contribute to intestinal enteropathy, the role of small non-coding RNAs, specifically microRNA (miRNA), has not been investigated. Using the simian immunodeficiency virus (SIV) infected non-human primate model of HIV pathogenesis, we investigated the effect of viral infection on the miRNA expression in the intestinal mucosa. SIV infection led to a striking decrease in the expression of mucosal miRNAs compared to uninfected controls. This decrease coincided with an increase in 5'-3'-exoribonuclease 2 protein and alterations in DICER1 and Argonaute 2 expression. Targets of depleted miRNA belonged to molecular pathways involved in epithelial proliferation, differentiation, and immune response. Decreased expression of several miRNA involved in maintaining epithelial homeostasis in the gut was localized to the proliferative crypt region of the intestinal epithelium. Our findings suggest that SIV induced decreased expression of miRNAs involved in epithelial homeostasis, disrupted expression of miRNA biogenesis machinery, and increased expression XRN2 are involved in the development of epithelial barrier dysfunction and gastroenteropathy.

    Importance MicroRNA (miRNA) regulate the development and function of intestinal epithelial cells and many viruses disrupt normal host miRNA expression. In this study, we demonstrate that SIV and HIV disrupt expression of miRNA in the small intestine during infection. The depletion of several key miRNA is localized to proliferative crypt region of the gut epithelium. These miRNA are known to control expression of genes involved in inflammation, cell death and epithelial maturation. Our data indicate that this disruption might be caused by altered expression of miRNA biogenesis machinery during infection. These findings suggest that the disruption of miRNA in the small intestine likely plays a role in intestinal enteropathy during HIV infection.

  • NEMO is essential for KSHV-encoded vFLIP K13-induced gene expression and protection against death receptor-induced cell death and its N-terminal 251 residues are sufficient for this process [PublishAheadOfPrint]

  • Kaposi's sarcoma associated herpesvirus-encoded viral FLICE inhibitory protein (vFLIP) K13 was originally believed to protect virally-infected cells against death receptor-induced apoptosis by interfering with caspase8/FLICE activation. Subsequent studies revealed that K13 also activates NF-B pathway by binding to NEMO/IKK subunit of an I kappa B kinase (IKK) complex and uses this pathway to modulate the expression of genes involved in cellular survival, proliferation and inflammatory response. However, it is not clear if K13 can also induce gene expression independent of NEMO/IKK. The minimum region of NEMO that is sufficient for supporting K13-induced NF-B has not been delineated. Furthermore, the contribution of NEMO and NF-B to the protective effect of K13 against death receptor-induced apoptosis remains to be determined. In this study, we have used microarray analysis on K13-expressing wild-type and NEMO-deficient cells to demonstrate that NEMO is required for modulation of K13-induced genes. Reconstitution of NEMO-null cells revealed that the N-terminal 251 amino acid residues of NEMO are sufficient for supporting K13-induced NF-B but fail to support TNFaalpha;-induced NF-B. K13 failed to protect NEMO-null cells against TNFaalpha;-induced cell death but protected those reconstituted with the NEMO(1-251) mutant. Taken collectively, our results demonstrate that NEMO is required for modulation of K13-induced genes and the N-terminal 251 amino acids of NEMO are sufficient for supporting K13-induced NF-B. Finally, the ability of K13 to protect against TNFaalpha;-induced cell death is critically dependent on its ability to interact with NEMO and activate NF-B.

    Importance Kaposi's sarcoma associated herpesvirus-encoded vFLIP K13 is believed to protect virally-infected cells against death receptor-induced apoptosis and to activate NF-B pathway by binding to adaptor protein NEMO/IKK. However, whether K13 can also induce gene expression independent of NEMO and the minimum region of NEMO that is sufficient for supporting K13-induced NF-B remain to be delineated. Furthermore, the contribution of NEMO and NF-B to the protective effect of K13 against death receptor-induced apoptosis is not clear. We demonstrate that NEMO is required for modulation of K13-induced genes and its N-terminal 251 amino acids are sufficient for supporting K13-induced NF-B. The ability of K13 to protect against TNFaalpha;-induced cell death is critically dependent on its ability to interact with NEMO and activate NF-B. Our results suggest that K13-based gene therapy approaches may have utility for the treatment of patients with NEMO mutations and immunodeficiency.

  • Reduction of microRNA-122 expression in IFNL3 CT+TT carriers and during progression of fibrosis in patients with chronic hepatitis C [PublishAheadOfPrint]

  • Mir-122 is highly expressed, in the liver, and stimulates Hepatitis C virus (HCV) replication, in vitro. IFNL3 polymorphisms and the expression of mir-122 have been associated with sustained virological response (SVR) to pegylated-interferon plus ribavirin, in patients with chronic hepatitis C (CHC). We investigated, in vivo, the relationship between mir-122 expression, IFNL3 polymorphism, fibrosis and response to treatment. Pre-treatment liver biopsies and serums from 133 patients with CHC were included. Sixty six patients achieved a SVR, and 64 failed to respond to the treatment (43 non-responders (NR) and 21 relapsers (RR)). All stages of fibrosis were represented, with 39, 50, 23, 19 patients respectively F1, F2, F3 and F4 (Metavir score). Mir-122 expression was assessed by RT-q-PCR and IFNL3 rs12979860 by direct sequencing. Hepatic mir-122 expression was higher in CC patients when compared to CT+TT, in total patients (p=0.025) and in NRs+RRs (p=0.013). Increased hepatic mir-122 was more strongly associated with complete early virological response (cEVR) (p=0.003) than with SVR (p=0.016). In multivariate analysis increased hepatic mir-122 was only associated with IFNL3 CC. Mir-122 was decreased in patients with F3-F4 as compared to patients with F1-F2 (p=0.01). Serum and hepatic expression of mir-122 were not associated. The association between mir-122 and IFNL3 is stronger than the association between mir-122 and response. Mir-122 may play a role in the early viral decline dependent of IFNL3 and innate immune response.

    Importance section Mir-122 plays a crucial role during HCV infection. Indeed, mir-122 binding within HCV genome stimulates its replication. Moreover, mir-122 is highly expressed within hepatocytes where it regulates many cellular pathways. A reduction of mir-122 expression has been suggested to be associated with responsiveness to IFN based therapy, in patients with chronic hepatitis C. Several independent genome wide association studies reported a strong association between IFNL3 polymorphism and responsiveness to IFN based therapy. We reported here a strong association between the expression of mir-122 and IFNL3 polymorphism, independently of the response to the treatment. Our data suggest that modification of mir-122 expression may play an important role in molecular mechanism associated with IFNL3 polymorphism. Moreover, we reported a reduction of mir-122 at more advanced stages of fibrosis, in patients with chronic hepatitis C.

  • Characterizing the molecular basis of attenuation of Marek's disease virus via in vitro serial passage identifies de novo mutations in the helicase-primase subunit gene UL5 and other candidates associated with reduced virulence [PublishAheadOfPrint]

  • Marek's disease (MD) is a lymphoproliferative disease of chickens caused by the oncogenic Gallid herpesvirus 2, commonly known as Marek's disease virus (MDV). MD vaccines, the primary control method, are often generated by repeated in vitro serial passage of this highly cell-associated virus to attenuate virulent MDV strains. To understand the genetic basis of attenuation, we used experimental evolution by serially passing three virulent MDV replicates generated from an infectious bacterial artificial chromosome (BAC) clone. All replicates became completely or highly attenuated indicating de novo mutation, and not selection amongst quasi-species existing in a strain, is the primary driving force for the reduction in virulence. Sequence analysis of the attenuated replicates revealed 41-95 single nucleotide variants (SNVs) at 2% or higher frequency in each population, and several candidate genes containing high frequency, nonsynonymous mutations. Five candidate mutations were incorporated into recombinant viruses to determine their in vivo effect. SNVs within UL42 (DNA polymerase auxiliary subunit) and UL46 (tegument) had no measurable influence, while two independent mutations in LORF2 (a gene of unknown function) improved survival time of birds but did not alter disease incidence. A fifth SNV located within UL5 (helicase-primase subunit) greatly reduced in vivo viral replication, increased survival time of birds, and resulted in only 0-11% disease incidence. This study shows that multiple genes, often within pathways involving DNA replication and transcriptional regulation, are involved in de novo attenuation of MDV and provides targets for the rational design of future MD vaccines.

    IMPORTANCE Marek's disease virus (MDV) is a very important pathogen in chickens that costs the worldwide poultry industry $1-2 billion annually. Marek's disease (MD) vaccines, the primary control method, are often produced by passing virulent strains in cell culture until attenuated. To understand this process, we identified all the changes in the viral genome that occurred during repeated cell passage. We find that a single mutation in the UL5 gene, which encodes a viral protein necessary for DNA replication, reduces disease incidence by 90% or more. In addition, other candidate genes were identified. This information should lead to the development of more effective and rationally-designed MD vaccines leading to improved animal health and welfare, and lower costs to consumers.

  • {beta}-HPV E6 expression inhibits p53 stabilization and increases the tolerance of genomic instability. [PublishAheadOfPrint]

  • Genus-bbeta; human papillomaviruses (bbeta;-HPVs) infections may contribute to the development of non-melanoma skin cancers. However, bbeta;-HPV genomes are found at too low a copy number in tumors for the virus to be necessary for tumor maintenance. Instead, they are hypothesized to destabilize the host genome by allowing the persistence of mutations that can drive tumorigenesis independent of the viral genome. Supporting this premise, we have previously shown that the expression of some bbeta;-HPV E6 proteins can attenuate p53 signaling in response to DNA damage.

    We show that bbeta;-HPV E6 proteins can prevent the stabilization of p53 in response to two types of genome destabilizing events, aberrant mitosis as well as disregulated centrosome duplication. The inability to stabilize p53 in response to these stimuli allows HPV 5, 8, and 38 E6 expressing cells to remain proliferatively active, leading to further genome deterioration in a proportion of the cells undergoing. These phenotypes are lost when a mutation is introduced into the p300 binding domain of HPV 8 E6 and by the transfection of mutated p300 that is resistant to HPV 5/8 E6 mediated degradation. This expands the understanding of the role of p300 plays a role in promoting faithful resolution of mitotic figures as well as proper centrosome duplication. Finally, we describe a phenomenon by which bi-nucleated cells are resolved via cytokinesis into two cells each with one nucleus. These data support the hypothesis that bbeta;-HPV infections may promote tumorigenesis via genome destabilization.

    IMPORTANCE: The work described in this manuscript provides support for the hypothesis that bbeta;-HPV infections may contribute to non-melanoma skin cancer by increasing the likelihood that tumorigenic mutations are introduced into the host cellrrsquo;s genome. We demonstrate that expression of the E6 protein from some of these viruses increases the tolerance of two genome destabilizing events, aberrant cell division and disregulated centrosome duplication. Typically these mutagenic occurrences elicit the stabilization of the tumor suppressor, p53, which prevents further propagation of cells containing these errors. We show that the expression of bbeta;-HPV E6 restricts this stabilization of p53, leading not only to continued cellular proliferation but also to further accumulation of similar mutagenic events. Finally, in addition to supporting a role for bbeta;-HPV infections in certain skin cancers, we present studies with a mutated bbeta;-HPV E6 protein that suggest the histone acetyltransferase, p300, plays a role in promoting genome stability during replication.

  • Protein ISGylation delays but does not overcome coronavirus proliferation in a model of fulminant hepatitis [PublishAheadOfPrint]

  • Coronaviruses express a de-ubiquitinating protein, the papain-like protease-2 (PLP2), that removes both ubiquitin and the ubiquitin-like Interferon (IFN) Stimulated Gene 15 (ISG15) protein from target proteins. ISG15 has antiviral activity against a number of viruses therefore, we examined the effect of ISG15 conjugation (ISGylation) in a model of acute viral hepatitis induced by the murine hepatitis virus (MHV)-3 coronavirus. Mice deficient in the ISG15 deconjugating enzyme, ubiquitin specific peptidase-18 (USP18), accumulate high levels of ISG15-conjugated proteins and are hypersensitive to type I IFN. Infecting USP18-/- mice with MHV-3 resulted in extended survival (8 pplusmn; 1.2 vs. 4 days), and improved liver histology, a decreased inflammatory response, and 1-2 logs lower viral titers compared to USP18+/+ mice. The suppression of viral replication was not due to increased IFN, since infected USP18-/- mice had neither increased hepatic IFN-aalpha;, -bbeta; or - mRNA nor circulating protein. Instead, delayed MHV-3 replication coincided with high levels of cellular ISGylation. Decreasing ISGylation by knockdown of the ISG15 E1 enzyme, Ube1L, in primary USP18+/+ and USP18-/- hepatocytes led to increased MHV-3 replication. Both in vitro and in vivo, increasing MHV-3 titers were coincident with increased PLP2 mRNA and decreased ISGylation over the course of infection. The pharmacologic inhibition of the PLP2 enzyme in vitro led to decreased MHV-3 replication. Overall, these results demonstrate the antiviral effect of ISGylation in an in vivo model of coronavirus-induced mouse hepatitis and illustrate that PLP2 manipulates the host innate immune response through the ISG15/USP18 pathway.

    Statement of Importance There have been a number of serious worldwide pandemics due to widespread infections by Coronavirus. This virus (in its many forms) is difficult to treat, in part because it is very good at finding "holes" in the way that the host (the infected individual) tries to control and eliminate the virus. In this study we demonstrate that an important host viral defence - the ISG15 pathway - is only partially effective in controlling severe Coronavirus infection. Activation of the pathway is very good at suppressing viral production, but over time the virus overwhelms the host response and the effects of the ISG15 pathway. This data provides insight into the host-viral interactions during Coronavirus infection and suggests that the ISG15 pathway is a reasonable target for controlling severe Coronavirus infection, though the best treatment will likely involve multiple pathways and targets.

  • A temporospatial map that defines specific steps at which critical surfaces in the Gag MA and CA domains act during immature HIV-1 capsid assembly in cells [PublishAheadOfPrint]

  • During HIV-1 assembly, Gag polypeptides target to the plasma membrane, where they multimerize to form immature capsids that undergo budding and maturation. Previous mutational analyses identified residues within the Gag matrix (MA) and capsid (CA) domains that are required for immature capsid assembly, and structural studies showed that these residues are clustered on four exposed surfaces in Gag. Exactly when and where the three critical surfaces in CA function during assembly are not known. Here, we analyzed how mutations in these four critical surfaces affect formation and stability of assembly intermediates in cells expressing the HIV-1 provirus. The resulting temporospatial map reveals that critical MA residues act during membrane targeting, residues in the C-terminal CA subdomain (CA-CTD) dimer interface are needed for stability of the first membrane-bound assembly intermediate, CA-CTD "base" residues are necessary for progression past the first membrane-bound intermediate, and residues in the N-terminal CA subdomain (CA-NTD) stabilize the last membrane-bound intermediate. Importantly, we found that all four critical surfaces act while Gag is associated with the cellular facilitators of assembly ABCE1 and DDX6. When correlated with existing structural data, our findings suggest the following model: Gag dimerizes via the CA-CTD-dimer interface just before or during membrane targeting; individual CA-CTD hexamers form soon after membrane targeting; and the CA-NTD hexameric lattice forms just prior to capsid release. This model adds an important new dimension to current structural models by proposing the potential order in which key contacts within the immature capsid lattice are made during assembly in cells.

    Importance While much is known about the structure of the completed HIV-1 immature capsid and domains of its component Gag proteins, much less is known about the sequence of events leading to formation of the HIV-1 immature capsid. Here we used biochemical and ultrastructural analyses to generate a temporospatial map showing the precise order in which four critical surfaces in Gag act during immature capsid formation in provirus-expressing cells. Because three of these surfaces make important contacts in the hexameric lattices that are found in the completed immature capsid, these data allow us to propose a model for the sequence of events leading to formation of the hexameric lattices. By providing a dynamic view of when and where critical Gag-Gag contacts form during the assembly process and how those contacts function in the nascent capsid, our study provides novel insights into how an immature capsid is built in infected cells.

  • Single-cell analysis uncovers extensive biological noise in poliovirus replication [PublishAheadOfPrint]

  • Viral infections often begin with a very small number of initiating particles. Accordingly, the outcome of an infection is likely to be affected by variability in the initial molecular interactions between virus and host. Here, we investigated the range of outcomes upon infection of single cells. We isolated individual cells infected with poliovirus at low or high multiplicity of infection (MOI) and measured viral genomic replication and infectious viral progeny in each cell. We first determined that at 7 hours post infection the positive to negative strand ratio in individual cells varies from 5:1 to more than 190:1, with and average of 20:1, suggesting a significant variability in RNA synthesis. We further found that while virus genome production is higher in cells infected at a high multiplicity, the production of infectious particles is largely independent of the number of viruses infecting each cell. Strikingly, by correlating RNA and particle production within individual infections, we uncovered a significant contribution of stochastic noise to the outcome of infection. At low MOI, stochastic influences appear as kinetic effects which are most critical at the initial steps in infection. At high MOI, stochastic influences appear to dictate the viruses ability to harness cellular resources. We conclude that biological noise is a critical determinant of the overall productivity of viral infections. The distinct nature of stochasticity in the outcome of infection by low and high numbers of viral particles may have important implications for our understanding of the determinants of successful viral infections.

    IMPORTANCE By correlating genome and particle production in single-cell infections, we elucidated sources of noise in viral infections. When a cell was infected by only a single infectious particle, variation in the kinetics of the initial steps of replication contributed significantly to the overall productivity of the infection. Additionally, variation in the distribution of subcellular resources impacted infections initiated by one or many infectious particles. We also observed that when a cell was infected with multiple particles, more genomes were produced, while particle production was hindered by an apparent cellular resource limit. Understanding variations in viral infections may illuminate the dynamics of infection and pathogenesis and has implications on virus adaptation and evolution.

  • Crystallographic and Glycan Microarray Analysis of Human Polyomavirus 9 VP1 identifies N-glycolyl neuraminic acid as a receptor candidate [PublishAheadOfPrint]

  • Human Polyomavirus 9 (HPyV9) is a closely related homologue of simian B-Lymphotropic Polyomavirus (LPyV). In order to define the architecture and receptor binding properties of HPyV9, we solved high-resolution crystal structures of its major capsid protein VP1 in complex with three putative oligosaccharide receptors identified by glycan microarray screening. Comparison with the known structure and glycan-binding properties of LPyV VP1 reveals that both viruses engage short sialylated oligosaccharides, with small but important differences in specificity. Surprisingly, HPyV9 VP1 preferentially binds sialyllactosamine compounds terminating in N-glycolyl neuraminic acid (Neu5Gc) compared to N-acetyl neuraminic acid (Neu5Ac), whereas LPyV does not exhibit such a preference. The structural analysis demonstrates that HPyV9 makes specific contacts, via hydrogen bonds, with the extra hydroxyl group present in Neu5Gc. Equivalent hydrogen bond cannot be formed by LPyV VP1.

    IMPORTANCE The most common sialic acid in humans is N-acetyl neuraminic acid (Neu5Ac), but various modifications give rise to more than fifty different sialic acid variants that decorate the cell surface. Unlike most mammals, humans cannot synthesize the sialic acid variant N-glycolyl neuraminic acid (Neu5Gc) due to a gene defect. Humans can however still acquire this compound from dietary sources. The role of Neu5Gc in receptor engagement and in defining viral tropism is only beginning to emerge, and structural analyses defining the differences in specificity for Neu5Ac and Neu5Gc are still rare. Using glycan microarray screening and high-resolution protein crystallography, we have examined the receptor specificity of a recently discovered human polyomavirus, HPyV9, and compare it to the closely related simian polyomavirus LPyV. Our study highlights critical differences in the specificities of both viruses, contributing to an enhanced understanding of the principles that underlie pathogen selectivity for modified sialic acids.

  • The measles virus hemagglutinin stalk: structure and function of the central fusion-activation and membrane-proximal segments [PublishAheadOfPrint]

  • The measles virus (MeV) membrane fusion apparatus consists of a fusion protein trimer and an attachment protein tetramer. To trigger membrane fusion the heads of the MeV attachment protein, hemagglutinin (H), bind cellular receptors while the 96-residue long H-stalk transmits the triggering signal. Structural and functional studies of the triggering mechanism of other Paramyxoviruses suggest that receptor-binding to their hemagglutinin-neuraminidase (HN) results in signal transmission through the central segments of their stalks. To gain insight into H-stalk structure and function we individually substituted its residues with cysteine. We then assessed how stable the mutant proteins are, how efficiently they can be cross-linked by disulfide bonds, whether cross-linking results in loss of function, and in this case whether disulfide bond reduction restores function. While many residues in the central segment of the stalk and in the "spacer" segment above it can be efficiently cross-linked by engineered disulfide bonds, we report here that residues 59-79 cannot, suggesting that the 20 membrane-proximal residues may not be engaged in a tetrameric structure. Rescue of function studies by disulfide bond reduction resulted in the re-definition and extension of the central fusion-activation segment as covering residues 84-117. In particular, we identified four residues located between positions 92-99 which function cannot be restored by disulfide bond reduction after cysteine mutagenesis. These mutant H-proteins reached the cell surface as complex oligomers, but could not trigger membrane fusion. We discuss these observations in the context of the stalk-exposure model of membrane fusion triggering by Paramyxoviruses.

    Importance Measles virus, while being targeted for eradication, still causes significant morbidity and mortality. Here we seek to understand how it enters cells by membrane fusion. Two viral integral membrane glycoproteins (hemagglutinin tetramers and fusion protein trimers) mediate the concerted receptor recognition and membrane fusion processes. Since previous studies have suggested that the hemagglutinin stalk transmits the triggering signal to the fusion protein trimer, we completed here an analysis of its structure and function by systematic Cys mutagenesis. Here we report that while certain residues of the central stalk segment confer specificity to the interaction with the fusion protein trimer, others are necessary to allow folding of the H-oligomer in a "standard" conformation conducive to fusion triggering and, yet other residues sustain the conformational change that transmits the fusion-triggering signal.

  • The limits of structural plasticity in a picornavirus capsid revealed by a massively expanded equine rhinitis A virus particle. [PublishAheadOfPrint]

  • The picornaviridae family of small, non-enveloped viruses includes major pathogens of humans and animals. They have positive-sense, single-stranded RNA genomes and the mechanism(s) by which these genomes are introduced into cells to initiate infection remains poorly understood. The structures of presumed uncoating intermediate particles of several picornaviruses show limited expansion and some increased porosity compared to the mature virions. Here, we present the cryo-electron microscopy structure of native equine rhinitis A virus (ERAV), together with the structure of a massively expanded ERAV particle, each at ~17 AAring; resolution. The expanded structure has large pores on the particle 3-fold axes and has lost the RNA genome and the capsid protein VP4. The expanded structure thus illustrates both the limits of structural plasticity in such capsids, and a plausible route by which genomic RNA might exit.

    Importance Picornaviruses are important animal and human pathogens that protect their genomic RNAs within a protective protein capsid. Upon infection this genomic RNA must be able to leave the capsid to initiate a new round of infection. This manuscript describes the structure of a unique, massively expanded state of equine rhinitis A virus that provides insight into how this exit might occur.

  • HIV-1 interacts with HERV-K (HML-2) Envelopes derived from human primary lymphocytes [PublishAheadOfPrint]

  • Human endogenous retroviruses (HERVs) are viruses that have colonized the germ-line and spread through vertical passage. Only the more recently acquired HERVs, such as the HERV-K (HML-2) group, maintain coding open reading frames. Expression of HERV-Ks has been linked to different pathological conditions, including HIV infection, but our knowledge on which specific HERV-Ks are expressed in primary lymphocytes is currently very limited.

    To identify the most expressed HERV-Ks in an unbiased manner, we analyzed their expression patterns in peripheral blood lymphocytes using Pacific Biosciences (PacBio) single-molecule real-time (SMRT) sequencing. We observe that three HERV-Ks (KII K102 and K18) constitute over 90% of the total HERV-K expression in primary human lymphocytes of five different donors. We also show experimentally that two of these HERV-K Env sequences (K18 and K102) retain their ability to produce full-length and post-translationally processed envelope proteins in cell culture. We show that HERV-K18 Env can be incorporated into HIV-1 but not SIV particles. Moreover, HERV-K18 Env incorporation into HIV-1 virions is dependent on HIV-1 matrix.

    Taken together, we generated high-resolution HERV-K expression profiles specific for activated human lymphocytes. We found that one of the most abundantly expressed HERV-Ks envelopes not only makes full-length a protein but also specifically interacts with HIV-1. Our findings raise the possibility that these endogenous retroviral Envs could directly influence HIV-1 replication.

    Importance Here we report the HERV-K expression profile of primary lymphocytes from 5 different healthy donors. We used a novel deep sequencing technology, (PacBio SMRT), that produces the long reads necessary to discriminate the complexity of HERV-K expression. We find that primary lymphocytes express up to 32 different HERV-K envelops, and that at least two of the most expressed Envs retain their ability to make a protein. Importantly one of them, the envelope glycoprotein of HERV-K18, is incorporated into HIV-1 in a HIV-Matrix specific fashion. The ramifications of such interactions are discussed in the last part of the manuscript as the possibility of HIV-1 target tissue broadening and immune evasion are considered.

  • Identification of conserved amino acids in pUL34 which are critical for function of the Pseudorabies Virus nuclear egress complex [PublishAheadOfPrint]

  • Nuclear egress of herpesvirus capsids is mediated by a conserved heterodimeric complex of two viral proteins, designated as pUL34 and pUL31 in Herpes simplex and Pseudorabies Virus (PrV). pUL34, a tail-anchored membrane protein, is targeted to the nuclear envelope and recruits pUL31 to the inner nuclear membrane (INM) to provide the docking and envelopment machinery for the nascent capsid. While the less conserved C-terminal part of pUL34 is required for correct positioning of the nuclear egress complex (NEC) at the INM, the conserved N-terminal part functions as docking site for pUL31. Since no crystal structure of the NEC is available yet, structure-function studies depend on mutational analyses with several approaches already performed for different herpesvirus NECs. Here, we extended our studies on PrV pUL34 identifying two asparagine residues (N75, N103) and a dileucine motif (LL166/167), adjacent to an ER retention signal, which are absolutely required for NEC function. While the pUL34-N75A substitution mutant is unable to interact with pUL31, pUL34-N103A is non-functional despite continuing complex formation. Surprisingly, mutant pUL34-G77A, which does not efficiently recruit pUL31 to the nuclear rim after cotransfection, nonetheless complements a UL34-deletion mutant indicating that the NEC may be stabilized by additional viral factors during infection.

    Importance: In the absence of a crystal structure of the nuclear egress complex (NEC) required for herpesvirus maturation, site-directed mutagenesis studies provide important information on critical amino acid residues. Here, we identify conserved amino acid residues in the membrane-bound component of the NEC which are relevant for its function.

  • An Evaluation of Phylogenetic Methods for Reconstructing Transmitted HIV Variants Using Longitudinal Clonal HIV Sequence Data [PublishAheadOfPrint]

  • A population of human immunodeficiency virus (HIV) within a host often descends from a single transmitted/founder virus. The high mutation rate of HIV, coupled with long delays between infection and diagnosis, make isolating and characterizing this strain a challenge. In theory, ancestral reconstruction could be used to recover this strain from sequences sampled in chronic infection; however, the accuracy of phylogenetic techniques in this context is unknown. To evaluate the accuracy of these methods, we applied ancestral reconstruction to a large panel of published longitudinal clonal and/or single-genome-amplification HIV sequence datasets with at least one intra-patient sequence set sampled within 6 months of infection or seroconversion (n=19,486 sequences, median [IQR] 49 (20-86) sequences/set). The consensus of the earliest sequences was used as the best possible estimate of the transmitted/founder. These sequences were compared to ancestral reconstructions from sequences sampled at later time points using both phylogenetic and phylogeny-naive methods. Overall, phylogenetic methods conferred a 16% improvement in reproducing the consensus of early sequences, compared to phylogeny-naive methods. This relative advantage increased with intra-patient sequence diversity (pllt;10-5) and the time elapsed between the earliest and subsequent samples (pllt;10-5). However, neither approach performed well for reconstructing ancestral indel variation, especially within indel-rich regions of the HIV genome. Although further improvements are needed, our results indicate that phylogenetic methods for ancestral reconstruction significantly outperform phylogeny-naive alternatives, and we identify experimental conditions and study designs that can enhance accuracy of transmitted/founder virus reconstruction.

    Importance When HIV is transmitted into a new host, most of the viruses fail to infect host cells. Consequently, an HIV infection tends to be descended from a single "founder" virus. A priority target for the vaccine research, these transmitted/founder viruses are difficult to isolate since newly-infected individuals are often unaware of their status for months or years, by which time the virus population has evolved substantially. Here, we report on the potential use of evolutionary methods to reconstruct the genetic sequence of the transmitted/founder virus from its descendants at later stages of an infection. These methods can recover this ancestral sequence with an overall error rate of about 2.3% mmdash; about 15% more information than if we had ignored the evolutionary relationships among viruses. Although there is no substitute for sampling infections at earlier points in time, these methods can provide useful information about the genetic makeup of transmitted/founder HIV.

  • Augmented replicative capacity of the boosting antigen improves the protective efficacy of heterologous prime-boost vaccine regimens [PublishAheadOfPrint]

  • Prime-boost immunization regimens have proven efficacious at generating robust immune responses. However, whether the level of replication of the boosting antigen impacts the magnitude and protective efficacy of vaccine-elicited immune responses remains unclear. To evaluate this, we primed mice with replication-defective adenovirus vectors expressing the lymphocytic choriomeningitis virus (LCMV) glycoprotein (GP) followed by boosting with either LCMV Armstrong, which is rapidly controlled, or LCMV CL-13, which leads to a more prolonged exposure to the boosting antigen. Although priming of naiiuml;ve mice with CL-13 normally results in T cell exhaustion and establishment of chronic infection, boosting with CL-13 resulted in potent recall CD8 T cell responses that were greater than those following boosting with Armstrong. Furthermore, following the CL-13 boost, a greater number of anamnestic CD8 T cells localized to the lymph nodes and exhibited Granzyme B expression, and conferred improved protection against Listeria and vaccinia challenges as compared with the Armstrong boost. Overall, our findings suggest that the replicative capacity of the boosting antigen influences the protective efficacy afforded by prime-boost vaccine regimens. These findings are relevant for optimizing vaccine candidates and suggest a benefit of robustly replicating vaccine vectors.

    Importance: The development of optimal prime-boost vaccine regimens is a high priority for the vaccine development field. In this study, we compared two boosting antigens with different replicative capacity. Boosting with a more highly replicative vector resulted in augmented immune responses and improved protective efficacy.

  • Support of the infectivity of hepatitis delta virus particles by the envelope proteins of different genotypes of hepatitis B virus [PublishAheadOfPrint]

  • The study examined how the envelope proteins of 25 variants of hepatitis B virus (HBV) genotypes A-I support hepatitis delta virus (HDV) infectivity. The assembled virions bore the same HDV ribonucleoprotein and differed only by HBV variant-specific envelope proteins coating the particles. The total HDV yield varied in 122-fold range. A residue Y (374) in the HDV-binding site was identified as critical for HDV assembly. The virions that bind the antibodies, which recognize the region that includes HBV matrix domain and predominantly but not exclusively immunoprecipitate the PreS1-containing virions, were termed as PreS1*-HDVs. Using in vitro infection of primary human hepatocytes (PHH), we measured the specific infectivity (SI), which is a number of HDV genomes/cell produced by infection and normalized by the PreS1*-MOI, which is a multiplicity of infection that reflects a number of PreS1*-HDVs/cell used in inoculum. The SI values varied in 160-fold range and indicated probable HBV genotype-specific trend in supporting HDV infectivity: Dggt;Bggt;Eggt;A. Three variants of genotypes B, C and D supported the highest SI values. We also determined the normalized index of infected PHH (NI), which is the percentage of HDV-infected hepatocytes normalized by the PreS1*-MOI. Comparison of the SI and NI values revealed that while a particular HBV variant may facilitate infection of relatively significant fraction of PHH, it may not always result in a considerable number of genomes that initiated the replication after the entry. The potential implications of these findings are discussed in the context of the mechanism of attachment/entry of HBV and HDV.

    IMPORTANCE The study advances the understanding of the mechanisms of (i) the attachment and entry of HDV and HBV; and (ii) transmission of HDV infection/disease.

  • Interferon-{alpha}/{beta} receptor signaling amplifies early pro-inflammatory cytokine production in the lung during Respiratory Syncytial Virus infection [PublishAheadOfPrint]

  • Type I IFNs are produced early upon virus infection and signal through the IFN-aalpha;/bbeta; receptor (IFNAR) to induce genes that encode proteins important for limiting viral replication and directing immune responses. To investigate the extent to which type I IFNs play a role in the local regulation of inflammation in the airways we examined their importance in early lung responses to infection with Respiratory Syncytial Virus (RSV). IFNAR-deficient (IFNAR1-/-) mice displayed increased lung viral load and weight loss during RSV infection. As expected, expression of IFN-inducible genes was markedly reduced in the lungs of IFNAR1-/- mice. Surprisingly, we found that levels of pro-inflammatory cytokines and chemokines in the lungs of RSV-infected mice were also greatly reduced in the absence of IFNAR. Furthermore, low levels of pro-inflammatory cytokines were also detected in the lungs of IFNAR1-/- mice challenged with non-infectious innate immune stimuli such as selected TLR agonists. Finally, recombinant IFN-aalpha; was sufficient to potentiate the production of inflammatory mediators in the lungs of wildtype mice challenged with innate immune stimuli. Thus, in addition to its well-known role in anti-viral resistance, type I IFN receptor signaling acts as a central driver of early pro-inflammatory responses in the lung. Inhibiting the effects of type I IFNs may therefore be useful in dampening inflammation in lung diseases characterized by enhanced inflammatory cytokine production.

    IMPORTANCE The initial response to viral infection is characterized by the production of interferons (IFNs). One group of IFNs, the type I IFNs, is produced early upon virus infection and signals through the IFN-aalpha;/bbeta; receptor (IFNAR) to induce proteins important for limiting viral replication and directing immune responses. Here we examined the importance of type I IFNs in early responses to Respiratory Syncytial Virus (RSV). Our data suggest that type I IFN production and IFNAR receptor signaling not only induce an anti-viral state but also serve to amplify pro-inflammatory responses in the respiratory tract. We also confirm this conclusion in another model of acute inflammation induced by non-infectious stimuli. Our findings are of relevance to human disease as RSV is a major cause of infant bronchiolitis and polymorphisms in the IFN system are known to impact disease severity.

  • Antibody-mediated immune control of a retrovirus does not require the microbiota. [PublishAheadOfPrint]

  • Commensal microbes are often required to control viral infection by facilitating host immune defenses. However, we found this does not hold true for retroviral infection. We report that retrovirus-resistant mice control the pathogen with virus-neutralizing antibodies independently of commensal microbiota. This is in contrast to orthomixoviruses and arenaviruses, where resistance is ablated in animals depleted of microbiota. Clearly, when it comes to anti-viral immunity, the role of the microbiota cannot be generalized.

  • Determinants for Membrane Association of the Hepatitis C Virus NS2 Protease Domain [PublishAheadOfPrint]

  • Hepatitis C virus (HCV) nonstructural protein 2 (NS2) is required for HCV polyprotein processing and particle assembly. It comprises an N-terminal membrane domain and a C-terminal, cytosolically oriented protease domain. Here, we demonstrate that the NS2 protease domain itself associates with cellular membranes. A single charged residue in the second aalpha;-helix of the NS2 protease domain is required for proper membrane association, NS2 protein stability and efficient HCV polyprotein processing.

  • Within Host Evolution Results in Antigenically Distinct GII.4 Noroviruses [PublishAheadOfPrint]

  • GII.4 noroviruses are known to rapidly evolve, with the emergence of a new primary strain every 2-4 years as herd immunity to the previously-circulating strain is overcome. Because viral genetic diversity is higher in chronic as compared to acute infection, chronically-infected immunocompromised people have been hypothesized as a potential source for new epidemic GII.4 strains. However, while some capsid protein residues are under positive selection and undergo patterned changes in sequence variation over time, the relationships between genetic variation and antigenic variation remains unknown. Based on previously-published GII.4 strains from a chronically-infected individual, we synthetically reconstructed VLPs representing an early and late isolates from a small bowel transplant patient chronically infected with norovirus, as well as the parental GII.4-2006b strain. We demonstrate that intra-host GII.4 evolution results in the emergence of antigenically distinct strains over time, comparable to the variation noted between chronologically predominant GII.4 strains GII.4-2006b and GII.4-2009. Our data suggest that in some individuals the evolution that occurs during a chronic norovirus infection overlaps with changing antigenic epitopes that are associated with successive outbreak strains and may select for isolates that are potentially able to escape herd immunity from earlier isolates.

    Importance Noroviruses are agents of gastrointestinal illness, infecting an estimated 21 million people per year in the United States alone. In healthy individuals, symptomatic infection typically resolves within 24-48 hours. However, symptoms may persist years in immunocompromised individuals, and development of successful treatments for these patients is a continued challenge. This work is relevant to the design of successful norovirus therapeutics for chronically infected patients, provides support for previous assertions that chronically infected individuals may serve as reservoirs for new, antigenically unique emergent strains, and furthers our understanding of GII.4 norovirus immune-driven molecular evolution.

  • Structural Analysis of Determinants to HBGA Binding Specificity in GI Noroviruses [PublishAheadOfPrint]

  • Human noroviruses (NoVs) cause acute epidemic gastroenteritis. Susceptibility to the majority of NoV infections is determined by genetically controlled secretor-dependent expression of histo-blood group antigens (HBGAs), which are also critical for NoV attachment to host cells. Human NoVs are classified into two major genogroups (GI and GII) with each genogroup further divided into several genotypes. GII NoVs are more prevalent and exhibit periodic emergence of new variants, suggested to be driven by altered HBGA-binding specificities and antigenic drift. Recent epidemiologic studies show increased activity among GI NoVs with some members showing the ability to bind non-secretor HBGAs. NoVs bind HBGAs through the protruding (P) domain of the major capsid protein VP1. GI NoVs, similar to GII, exhibit significant sequence variations in the P domain; it is unclear how these variations affect HBGA binding specificities. To understand the determinants of possible strain-specific HBGA binding among GI NoVs, we determined the structure of the P domain of a GI.7 clinical isolate and compared it to the P domain structures of previously determined GI.1 and GI.2 strains. Our crystallographic studies revealed significant structural differences particularly in the loop regions of the GI.7 P domain altering its surface topography and electrostatic landscape and potentially indicating antigenic variation. The GI.7 strain bound to H- and A-type, Lewis secretor and Lewis non-secretor families of HBGAs allowing us to further elucidate the structural determinants of non-secretor HBGA binding among GI NoVs and to infer several contrasting and generalizable features of HBGA binding in the GI NoVs.

    Importance Human noroviruses (NoVs) cause acute epidemic gastroenteritis. Recent epidemiological studies have shown increased prevalence of genogroup I (GI) NoVs. Although secretor-positive status is strongly correlated with NoV infection, cases of NoV infection associated with secretor-negative individuals are reported. Biochemical studies have shown that GI NoVs exhibit genotype-dependent binding to non-secretor histo blood group antigens (HBGAs). From our crystallographic studies of a GI.7 NoV, in comparison with previous studies on GI.1 and G1.2 NoVs, we show genotypic differences translate to extensive structural changes in the loop regions that significantly alter the surface topography and electrostatic landscape of the P domain; these features may be indicative of antigenic variations contributing to serotypic differentiation in GI NoVs, and also differential modulation of the HBGA binding characteristics. A significant finding is that the threshold length and the structure of one of the loops are critical determinants in the GI NoVs binding to non-secretor HBGAs.

  • Efficient Reovirus- and Measles Virus-mediated Pore Expansion During Syncytium Formation is Dependent on Annexin A1 and Intracellular Calcium [PublishAheadOfPrint]

  • Orthoreovirus fusion associated small transmembrane (FAST) proteins are dedicated cell-cell fusogens responsible for multinucleated syncytia formation, and are virulence determinants of the fusogenic reoviruses. While numerous studies on the FAST proteins and enveloped viral fusogens have delineated steps involved in membrane fusion and pore formation, little is known about the mechanics of pore expansion needed for syncytiogenesis. We now report that RNAi knockdown of annexin A1 (AX1) expression dramatically reduced both reptilian reovirus p14 and measles virus F and H protein-mediated pore expansion during syncytiogenesis, but had no effect on p14-induced pore formation. A similar effect was obtained by chelating intracellular calcium, which dramatically decreased syncytiogenesis in the absence of detectable effects on p14-induced pore formation. Co-immunoprecipitation revealed calcium-dependent interaction between AX1 and p14 or measles virus F and H proteins, and fluorescence resonance energy transfer (FRET) demonstrated calcium-dependent p14-AX1 interactions in cellulo. Furthermore, antibody inhibition of extracellular AX1 had no effect on p14-induced syncytium formation, but did impair cell-cell fusion mediated by the endogenous muscle cell fusion machinery in C2C12 mouse myoblasts. AX1 can therefore exert diverse, fusogen-specific effects on cell-cell fusion, functioning as an extracellular mediator of differentiation-dependent membrane fusion or as an intracellular promoter of post-fusion pore expansion and syncytium formation following viral-mediated cell-cell fusion.

    IMPORTANCE Numerous enveloped viruses, and nonenveloped fusogenic orthoreoviruses, encode membrane fusion proteins that induce syncytium formation, which has been linked to viral pathogenicity. Considerable insights into the mechanisms of membrane fusion have been obtained, but processes that drive post-fusion expansion of fusion pores to generate syncytia are poorly understood. This study identifies intracellular calcium and annexin A1 (AX1) as key factors required for efficient pore expansion during syncytium formation mediated by the reptilian reovirus p14 and measles virus F and H fusion protein complexes. Involvement of intracellular AX1 in syncytiogenesis directly correlates with a requirement for intracellular calcium in p14-AX1 interactions and pore expansion, but not membrane fusion and pore formation. This is the first demonstration that intracellular AX1 is involved in pore expansion, and suggests the AX1 pathway may be a common host cell response needed to resolve virus-induced cell-cell fusion pores.

  • Vesiculovirus neutralization by natural IgM and complement [PublishAheadOfPrint]

  • Because of its very low human seroprevalence, vesicular stomatitis virus (VSV) has promise as a systemic oncolytic agent for human cancer therapy. However, as demonstrated in this manuscript, VSV infectious titer drops by 4 logs during the first hour of exposure to nonimmune human serum. This neutralization occurs relatively slowly and is mediated by the concerted actions of natural IgM and complement. Marabavirus, whose G protein is about 80% homologous to that of VSV, is relatively resistant to the neutralizing activity of nonimmune human serum. We therefore constructed and rescued a recombinant VSV whose G gene was replaced by the corresponding gene from Marabavirus. Comparison of the parental and Maraba G-substituted VSVs revealed near-identical host range properties and replication kinetics on a panel of tumor cell lines. Moreover, in contrast to the parental VSV, the Maraba G-substituted VSV was resistant to nonimmune human serum. Overall, our data suggest that Maraba G-substituted VSV should be further investigated as a candidate for human systemic oncolytic virotherapy applications.

    Importance Section: Oncolytic virotherapy is a promising approach for the treatment of disseminated cancers, but antibody neutralization of circulating oncolytic virus particles remains a formidable barrier. In this work, we have developed a pseudotyped VSV with a glyco protein of Maraba virus, a closely related but serologically distinct member of the Rhabdoviridae family, which demonstrated greatly diminished susceptibility to both non-immune and VSV-immune sera neutralization. Maraba G-substituted VSV or lentiviral vectors should therefore be further investigated as a candidate for human systemic oncolytic virotherapy and gene therapy applications.

  • Cell Surface Vimentin is an Attachment Receptor for Enterovirus 71 [PublishAheadOfPrint]

  • Enterovirus 71 (EV71) is a highly transmissible pathogenic agent that causes severe central nervous system diseases in infected infants and young children. Here, we reported that EV71 VP1 protein could bind to vimentin intermediate filaments expressed on host cell surface. Soluble vimentin or an antibody against vimentin could inhibit the binding of EV71 to host cells. Accompanied with the reduction of vimentin expression on cell surface, the binding of EV71 to cells was remarkably decreased. Further evidence showed that the N terminal of vimentin is responsible for the interaction between EV71 and vimentin. These results indicated that vimentin on host cell surface may serve as an attachment site that mediated the initial binding and subsequently increased the infectivity of EV71.

    Importance This study delivers important findings on the roles of vimentin filaments in relation to EV71 infection and provides information that not only improved our understanding of EV71 pathogenesis, but also presents us with potentially new strategies for the treatment of diseases caused by EV71 infections.

  • Differential sensitivities of tetherin isoforms to counteraction by primate lentiviruses [PublishAheadOfPrint]

  • The mammalian antiviral membrane protein tetherin (BST2/CD317) can be expressed as two isoforms derived from differential translational initiation. The shorter isoform of the human protein (S-tetherin) lacks the first 12 amino acids of the longer (L-) tetherin cytoplasmic tail, which includes a tyrosine motif that acts as both an endocytic recycling signal and a determinant of virus-induced NFB activation. S-tetherin is also reported to be less sensitive to the prototypic viral antagonist, HIV-1 Vpu. Here we analyzed the relative sensitivities of L- and S-tetherins to primate lentiviral countermeasures. We show that the reduced sensitivity of S-tetherin to HIV-1 Vpu is a feature of all group M proteins including those of transmitted founder viruses, primarily because it cannot be targeted for endosomal degradation owing to the truncation of its cytoplasmic tail. By contrast, both isoforms of the human and rhesus macaque tetherins display an equal sensitivity to non-degradative lentiviral countermeasures of HIV-2 and SIVmac respectively. Surprisingly, however, the Vpu proteins encoded by SIVs of African guenons, as well as that from a recently isolated highly pathogenic HIV-1 group N, do not discriminate between tetherin isoforms. Together these data suggest that the group M HIV-1 Vpu primarily adapted to target L-tetherin upon zoonotic transmission from chimpanzees, and further we speculate that functions specifically associated with this isoform, such as proinflammatory signaling, play key roles in human tetherinrrsquo;s antiviral function in vivo.

    Importance The ability of HIV-1 and related viruses to counteract a host antiviral protein, tetherin, is strictly maintained. The adaptation of the HIV-1 Vpu protein to counteract human tetherin is thought to have been one of the key events in the establishment of the HIV/AIDS pandemic. Recent evidence shows that tetherin is expressed as two isoforms, and that Vpu preferentially targets the longer form of tetherin. Here we show that unlike other virally-encoded countermeasures such as those from primate viruses related to HIV-1, the enhanced ability to counteract the long tetherin isoform is conserved amongst HIV-1 strains that make up the majority of the human pandemic. This correlates with the ability of Vpu to induce long tetherin degradation. We speculate that functions associated with the human version of this isoform, such as an inflammatory signaling capacity, selected for Vpurrsquo;s enhanced targeting of long tetherin during its adaptation to humans.

  • Hepatitis C virus NS5A hijacks ARFGAP1 to maintain a PI4P-enriched microenvironment [PublishAheadOfPrint]

  • Phosphatidylinositol 4-phosphate (PI4P) is well known to be upregulated during hepatitis C virus (HCV) replication. The role of PI4 kinases in HCV has been extensively investigated. Whether the PI4P phosphatase Sac1 is altered by HCV remains unclear. Here we identified ARFGAP1 to be a novel host factor for HCV replication. We further show that Sac1 interacts with ARFGAP1 and inhibits HCV replication. The elevation of PI4P induced by HCV NS5A is abrogated when the COPI pathway is inhibited. We also found an interaction between NS5A and ARFGAP1. Furthermore, we identified a conserved cluster of positively charged amino acids in NS5A critical for interaction between NS5A and ARFGAP1, induction of PI4P and HCV replication. Our data demonstrate that ARFGAP1 is a host factor for HCV RNA replication. ARFGAP1 is hijacked by HCV NS5A to remove COPI cargo Sac1 from the site of HCV replication to maintain high levels of PI4P. Our findings provide an additional mechanism by which HCV enhances formation of a PI4P-rich environment.

    Importance PI4P is enriched in the replication area of HCV; however, whether PI4P phosphatase Sac1 is subverted by HCV is not established. The detailed mechanism how COPI contributes to viral replication remains unknown, though COPI components were hijacked by HCV. We demonstrate that ARFGAP1 is hijacked by HCV NS5A to remove COPI cargo Sac1 from HCV replication area to maintain high level PI4P generated by NS5A. Furthermore, we identify a conserved cluster of positively charged amino acids in NS5A, which is critical for interaction between NS5A and ARFGAP1, induction of PI4P, and HCV replication. This study will shed mechanism insight on how other RNA virus hijacks COPI and Sac1.

  • Bona fide evidence for natural vertical transmission of Infectious Salmon Anemia Virus (ISAV) in freshwater brood stocks of farmed Atlantic Salmon (Salmo salar) in Southern Chile. [PublishAheadOfPrint]

  • Infectious salmon anemia (ISA) is a severe disease that affects farmed Atlantic salmon (Salmo salar), causing outbreaks in sea water in most salmon-producing countries worldwide and with particular aggressiveness in southern Chile. The etiological agent of the disease is a virus belonging to the Orthomyxoviridae family, named the Infectious Salmon Anemia Virus (ISAV). Although it has been suggested that the virus can be vertically transmitted, even in fresh water, there is a lack of compelling experimental evidence to confirm this. Here we demonstrate that two brood stock female adult specimens that harbored the virus systemically, though without clinical signs, significant levels of putative viral loads in their ovarian fluid as well as in the eggs. The target virus corresponded to an HPR-3 variant, which is known to be virulent in seawater and responsible for recent and past outbreaks of the disease in Chile. Additionally, the virus recovered from the fluid as well as from the interior of the eggs, was fully infective to a susceptible fish cell line. To our knowledge, this is the first robust evidence demonstrating on the one hand, mother-to-offspring vertical transmission of the infective virus; and on the other, the asymptomatic transmission of a virulent form of the virus in freshwater fish.

    IMPORTANCE PARAGRAPH The robustness of the data presented here will contribute to a better understanding of the biology of the virus but most importantly, will constitute a key management tool in the control of an aggressive agent constantly threatening the sustainability of the global salmon industry.

  • Factors Associated with SIV Transmission in a Natural African Nonhuman Primate Host in the Wild [PublishAheadOfPrint]

  • African green monkeys (AGMs) are naturally infected with SIV at high prevalence levels and do not progress to AIDS. Sexual transmission is the main transmission route in AGM, while maternal-to-infant transmission (MTIT) is negligible. We investigated SIV transmission in wild AGMs, to assess whether or not high SIV prevalence is due to differences in mucosal permissivity to SIV (i.e., whether the genetic bottleneck of viral transmission reported in humans and macaques is also observed in AGMs in the wild). We tested 121 sabaeus AGMs (Chlorocebus sabaeus) from Gambia and found that 53 were SIV-infected (44%). By combining serology and viral load quantitation we identified 4 acutely infected AGMs in which we assessed the diversity of the quasispecies by single genome amplification (SGA) and documented a single strain transmission. We thus show that natural SIV transmission in the wild is associated with a similar genetic bottleneck to that described for mucosal HIV transmission in humans. Flow cytometry assessment of the immune cell populations did not identify major differences between infected and uninfected AGM. The expression of the SIV coreceptor CCR5 on CD4+ T cells dramatically increased in adults, being higher in infected vs. uninfected infant and juvenile AGMs. Thus, the limited SIV MTIT in natural hosts appears to be due to low target cell availability in newborns and infants, which supports HIV MTIT prevention strategies aimed at limiting the target cells at mucosal sites. Combined, the (i) extremely high prevalence in sexually active AGMs, (ii) very efficient SIV transmission in the wild, and (iii) existence of a fraction of multiparous females that remain uninfected in spite of massive exposure to SIV, identifies wild AGMs as an acceptable model of exposed, uninfected individuals.

    Importance We report an extensive analysis of the natural history of SIVagm infection in its sabaeus monkey host, the African green monkey species endemic to West Africa. Virtually no study has investigated the natural history of SIV infection in the wild. The novelty of our approach is that we report for the first time that SIV infection has no discernible impact on the major immune cell populations in natural hosts, thus confirming the nonpathogenic nature of SIV infection in the wild. We also focused on the correlates of SIV transmission and we report, also for the first time, that SIV transmission in the wild is characterized by a major genetic bottleneck, similar to that described for HIV-1 transmission in humans. Finally, we report here that the restriction of target cell availability is a major correlate of the lack of SIV transmission to the offspring in natural hosts of SIVs.

  • Antagonistic Determinants Controlling Replicative and Latent States of Human Cytomegalovirus Infection [PublishAheadOfPrint]

  • The mechanisms by which viruses persist, and particularly those by which viruses actively contribute to their own latency, have been elusive. Here we report the existence of opposing functions encoded within a polycistronic locus of the human cytomegalovirus (HCMV) genome that regulate cell-type dependent viral fates: replication and latency. The locus, referred to as the UL133/8 locus, encodes four proteins, pUL133, pUL135, pUL136, and pUL138. As part of the ULbrrsquo; region of the genome, the UL133/8 locus is lost upon serial passage of clinical strains of HCMV in cultured fibroblasts and is, therefore, considered dispensable for replication in this context. Strikingly, we could not reconstitute infection in permissive fibroblasts from bacterial artificial chromosome clones of the HCMV genome where UL135 alone was disrupted. The loss of UL135 results in complex phenotypes and can ultimately be overcome by infection at high multiplicities. The requirement for UL135, but not the entire locus led us to hypothesize that another gene in this locus suppressed virus replication in the absence of UL135. The defect associated with the loss of UL135 was largely rescued by the additional disruption of the UL138 latency determinant, indicating a requirement for UL135 for virus replication when UL138 is expressed. In the CD34+ hematopoietic progenitor model of latency, viruses lacking only UL135 were defective for viral genome amplification and reactivation. Taken together, these data indicate that UL135 and UL138 comprise a molecular switch whereby UL135 is required to overcome UL138-mediated suppression of virus replication to balance states of latency and reactivation.

    IMPORTANCE Mechanisms by which viruses persist in their host remain one of the most poorly understood phenomena in virology. Herpesviruses, including HCMV, persist in an incurable, latent state that has profound implications for immune compromised individuals, including transplant patients. Further, the latent coexistence of HCMV may increase the risk of age-related pathologies including vascular disease. The key to controlling or eradicating HCMV lies in understanding the molecular basis for latency. In this work, we describe complex interplay between two viral proteins, pUL135 and pUL138, which antagonize one another in infection to promote viral replication or latency, respectively. We previously described the role of pUL138 in suppressing virus replication for latency. Here we demonstrate a role of pUL135 in overcoming pUL138-mediated suppression for viral reactivation. From this work, we propose that pUL135 and pUL138 constitute a molecular switch balancing states of latency and reactivation.

  • DENGUE VIRUS AND HEPATITIS C VIRUS-INDUCED REPLICATION AND ASSEMBLY COMPARTMENTS: THE ENEMY INSIDE - CAUGHT IN THE WEB. [PublishAheadOfPrint]

  • Dengue virus (DENV) and hepatitis C virus (HCV), members of the family Flaviviridae, are global human health concerns. As positive strand RNA viruses, they both replicate in the cytoplasm of infected cells and induce distinct membranous replication compartments where most, if not all steps of the viral lifecycle occur. This Gem article briefly reviews the most recent insights into the architecture and functional properties of membranous replication and assembly sites induced by DENV and HCV.

  • Mechanisms of RIG-I-like Receptor Activation and Manipulation by Viral Pathogens [PublishAheadOfPrint]

  • RIG-I-like receptors (RLRs) play important roles in the host defense to numerous viral pathogens. Since their discovery, much light has been shed on the molecular details of how these cytoplasmic viral RNA receptors sense viral infection and orchestrate antiviral innate immunity. Intriguingly, in addition to viral RNA binding, a series of posttranslational modifications (PTMs) is required for the rapid activation of RLRs, and inversely, for the prevention of aberrant innate immune signaling. Recent discoveries have shown that viruses manipulate the PTMs of RLRs to escape innate immune detection. This article highlights some of these recent findings in this fast-evolving field.

  • Co-circulation of three HA and two NA subtypes of avian influenza viruses in Huzhou, China, April 2013: implication for the origin of the novel H7N9 virus. [PublishAheadOfPrint]

  • We detected three avian influenza HA subtypes (H7, H9 and H5) and two NA subtypes (N9 and N2), as well as H7N9-related reassortant intermediates H9N9, co-circulating among poultry in Huzhou, China, during April 2013. The co-circulation not only reveals that Huzhou is one of the geographic origins of the novel H7N9 virus, but also poses a potential threat to humans in the future.

  • An immature retroviral RNA genome resembles a kinetically trapped intermediate state [PublishAheadOfPrint]

  • Retroviral virions initially assemble in an immature form that differs from that of the mature infectious particle. The RNA genomes in both immature and infectious particles are dimers and interactions between the RNA dimer and the viral Gag protein ensure selective packaging into nascent immature virions. We used high-sensitivity SHAPE to obtain nucleotide-resolution structural information from scarce, femtomole quantities of Moloney murine leukemia virus (MuLV) RNA inside authentic virions and from viral RNA extracted from immature (protease-minus) virions. Our secondary structure model of the dimerization and packaging domain indicated that a stable intermolecular duplex known as PAL2, previously shown to be present in mature infectious MuLV particles, was sequestered in an alternate stem-loop structure inside immature virions. The intermediate state corresponded closely to a late folding intermediate that we detected in time-resolved studies of the free MuLV RNA, suggesting that the immature RNA structure reflects trapping of the intermediate folding state by interactions in the immature virion. We propose models for the RNA-protein interactions that trap the RNA in the immature state and for the conformational rearrangement that occurs during maturation of virion particles.

    Importance The structure of the RNA genome in mature retroviruses has been studied extensively whereas very little was known about RNA structure in immature virions. The immature RNA structure is important because it is the form initially selected for packaging in new virions, and may have other roles. This lack of information was due to the difficulty of isolating sufficient viral RNA for study. In this work, we apply a high-sensitivity and nucleotide-resolution approach to examine the structure of the dimerization and packaging domain of the Moloney murine leukemia virus. We find that the genomic RNA is packaged in a high-energy state, suggesting that interactions within the virion hold or capture the RNA before it reaches its most stable state. The new structural information makes it possible to propose models for the conformational changes in the RNA genome that accompany retroviral maturation.

  • An important role for MAVS in the KSHV lifecycle [PublishAheadOfPrint]

  • Kaposirrsquo;s sarcoma-associated herpesvirus (KSHV) has been shown to be recognized by two families of pattern recognition receptors (PRRs), Toll-like receptors (TLR) and NOD-like receptors (NLRs). Here we show that MAVS and RIG-I (retinoic acid-inducible gene 1), an RLR family member, also have a role in suppressing KSHV replication and production. In the context of primary infection, we show that in cells with depleted levels of MAVS or RIG-I, KSHV transcription is increased, while IFN-bbeta; induction is attenuated. We also observed that MAVS and RIG-I are critical during the process of reactivation. Depletion of MAVS and RIG-I prior to reactivation led to increased viral load and production of infectious virus. Finally, MAVS depletion in latent KSHV-infected B cells leads to increased viral gene transcription. Overall this study suggests a role for MAVS and RIG-I signaling during different stages of the KSHV lifecycle.

    Importance We show that RIG-I (retinoic acid-inducible gene 1), and its adaptor protein, MAVS, can sense Kaposirrsquo;s sarcoma-associated herpesvirus (KSHV) infection and that these proteins can suppress KSHV replication following primary infection and/or viral reactivation.

  • Genome Segregation and Packaging Machinery in Acanthamoeba polyphaga Mimivirus is Reminiscent of Bacterial Apparatus [PublishAheadOfPrint]

  • Genome packaging is a critical step in the virion assembly process. The putative ATP driven genome packaging motor of Acanthamoeba poylphaga mimivirus (APMV) and other nucleocytoplasmic large DNA viruses (NCLDVs) is a distant ortholog of prokaryotic chromosome segregation motors like FtsK and HerA rather than other viral packaging motors such as large terminase. Intriguingly, APMV also encode for two other components, three putative serine recombinases and a putative type II topoisomerase, both of which are essential for chromosome segregation in prokaryotes. Based on our analyses of these components and taking limited available literature into account, here we propose a model for genome segregation and packaging in APMV for the first time that can possibly be extended to NCLDV subfamilies except perhaps poxviridiae and ascoviridae. This model might represent a unique variation of the prokaryotic system acquired and contrived by the large DNA viruses of eukaryotes. It is also consistent with previous observations that unicellular eukaryotes like amoeba are melting pots for the advent of chimeric organisms with novel mechanisms.

    Importance Extremely large viruses with DNA genomes infect wide range of eukaryotes, from human beings to amoeba, from crocodile to algae. These large DNA viruses, unlike their much smaller cousins, have the capability of making most of the protein components required for their multiplication. Once they infect the cell these viruses set up viral replication centres known as viral factories to carry out their multiplication with very little help from the host. Our sequence analyses show that there is a remarkable similarity between prokaryotes (bacteria and archaea) and large DNA viruses such as mimivirus, vaccinia virus, pandoravirus in the way they process their newly synthesized genetic material to make sure that only one copy of the complete genome is generated and is meticulously placed inside the newly synthesized viral particle. These findings have important evolutionary implications about the origin and evolution of large viruses.

  • SIV and HIV-1 matrix proteins specify different capabilities to modulate B cell growth [PublishAheadOfPrint]

  • Exogenous HIV-1 matrix protein p17 (p17) deregulates the function of different cells after its N-terminal loop (AT20) binding to the chemokine receptors CXCR1 and CXCR2. One site within AT20 has been recently found to be the major determinant of viral fitness following transmission of simian immunodeficiency virus (SIV) to the human host. Therefore, we asked whether SIV matrix protein (SIV MA) was already capable of interacting with CXCR1 and CXCR2 and mimic p17 biological activities rather than being it a newly acquired function during host adaptation. Here we show that SIV MA binds with the same affinity of p17 to CXCR1 and CXCR2 and displays both p17 pro-angiogenic on human primary endothelial cells and chemotactic activity on human primary monocytes and B cells. However, SIV MA exhibited a higher degree of plasticity than p17 in the C-terminus, a region known to play a role in modulating B cell growth. Indeed, differently from p17, SIV MA was found to activate the PI3K/Akt signaling pathway and strongly promote B cell proliferation and clonogenic activity. Interestingly, we have recently highlighted the existence of a Ugandan HIV-1 strain-derived p17 variant (S75X) with the same B cell growth-promoting activity of SIV MA. Computational modeling allowed us to hypothesize an altered C-terminus/core region interaction behind SIV MA and S75X activity. This finding points on the appearance of a structural constraint in the p17 C-terminus aimed to control B cell growth, which may offer the possibility of understanding the evolutionary trajectory of HIV-1.

    Importance The HIV-1 matrix protein p17 (p17) deregulates the biological activities of different cells after binding to the chemokine receptors CXCR1 and CXCR2. The p17 functional domain responsible for receptors interaction includes an amino acid which is considered the major determinant of SIV replication in humans. Therefore, we asked whether SIV matrix protein (SIV MA) already had the capability to bind to both chemokine receptors rather than being a newly function acquired during host adaptation. Here we show that SIV MA binds to CXCR1 and CXCR2 and fully mimics the p17 pro-angiogenic and chemokine activity. However, it differs from p17 in its capability to signal into B cells and promote B cell growth and clonogenicity. Computational analysis suggests that accumulation of mutations in the C-terminal region may have led to a further SIV MA adaptation to the human host. This finding offers the possibility to understand the evolutionary trajectory of HIV-1.

  • Mucosal immunization with a candidate universal influenza vaccine reduces virus transmission in a mouse model [PublishAheadOfPrint]

  • Pandemic influenza is a major public health concern, but conventional strain-matched vaccines are unavailable early in a pandemic. Candidate "universal" vaccines targeting viral antigens nucleoprotein (NP) and matrix 2 (M2), which are conserved among all influenza A virus strains and subtypes, could be manufactured in advance for use at the onset of a pandemic. These vaccines do not prevent infection, but can reduce disease severity, deaths, and virus titers in the respiratory tract. We hypothesized that such immunization may reduce virus transmission from vaccinated, infected animals. To investigate this hypothesis, we studied mouse models for direct contact and airborne transmission of H1N1 and H3N2 influenza viruses. We established conditions under which virus transmission occurs, and showed that transmission efficiency is determined in part at the level of host susceptibility to infection. Our findings indicate that virus transmission between mice has both airborne and direct contact components. Finally, we demonstrated that immunization with recombinant adenovirus vectors expressing NP and M2 significantly reduced transmission of virus to co-housed, unimmunized mice in comparison to controls. These findings have broad implications for the impact of conserved antigen vaccines, not only in protecting the vaccinated individual but also in protecting others by limiting influenza virus transmission and potentially reducing the size of epidemics.

    IMPORTANCE Using a mouse model of influenza A virus transmission, we demonstrate that a candidate "universal" influenza vaccine both protects vaccinated animals from lethal infection and reduces transmission of virus from vaccinated to non-vaccinated mice. This vaccine induces immunity against proteins conserved between all known influenza A virus strains and subtypes, so it could be used early in a pandemic before conventional strain-matched vaccines are available and could potentially reduce spread of infection in the community.

  • In Memoriam John J. Holland (1929-2013): a Pioneer in Molecular Virology [PublishAheadOfPrint]

  • John J. Holland, Professor Emeritus of Biological Sciences at the University of California, San Diego, died in October, 2013. John was a pioneer in RNA virology, changing the way we think about RNA virus evolution. He was a scientific leader who served the virology community at the international, national, and university levels. John was an outstanding teacher and mentor who will be greatly missed. We thank John's many friends, colleagues, trainees, and family for contributing their remembrances of this remarkable scientist.

  • Conserved features of the PB2 627 domain impact influenza virus polymerase function and replication [PublishAheadOfPrint]

  • Successful replication of influenza virus requires the coordinated expression of viral genes and replication of the genome by the viral polymerase, composed of the subunits PA, PB1 and PB2. Polymerase activity is regulated by both viral and host factors, yet the mechanisms of regulation and how they contribute to viral pathogenicity and tropism are poorly understood. To characterize these processes, we created a series of mutants in the 627 domain of the PB2 subunit. This domain contains a conserved "P[F/P]AAAPP" sequence motif and the well-described amino acid 627 whose identity regulates host range. A lysine present at position 627 in most mammalian viral isolates creates a basic face on the domain surface and confers high activity in humans compared to the glutamic acid found at this position in avian isolates. Mutating the basic face or the P[F/P]AAAP motif impaired polymerase activity, assembly of replication complexes and viral replication. Most of these residues are required for general polymerase activity, whereas PB2 K586 and R589 were preferentially required for function in human versus avian cells. Thus, these data identify residues in the 627 domain and other viral proteins that regulate polymerase activity, highlighting the importance of the surface charge and structure of this domain for virus replication and host adaptation.

    IMPORTANCE Influenza virus faces barriers to transmission across species as it emerges from its natural reservoir in birds to infect mammals. The viral polymerase is an important regulator of this process and undergoes discrete changes to adapt to replication in mammals. Many of these changes occur in the polymerase subunit PB2. Here we describe the systematic analysis of a key region in PB2 that controls species-specific polymerase activity. We report the importance of conserved residues that contribute to the overall charge of the protein as well as those that likely affect protein structure. These findings provide further insight into the molecular events dictating species-specific polymerase function and viral replication.

  • Pseudorabies Virus pUL46 induces activation of ERK1/2 and regulates herpesvirus induced nuclear envelope breakdown [PublishAheadOfPrint]

  • Herpesvirus capsid morphogenesis occurs in the nucleus, while final maturation takes place in the cytosol requiring translocation of capsids through the nuclear envelope. The nuclear egress complex consisting of homologs of herpes simplex virus pUL31 and pUL34, is required for efficient nuclear egress via primary envelopment-deenvelopment. Recently, we described an alternative mode of nuclear escape by fragmentation of the nuclear envelope induced by replication competent pUL31 and pUL34 deletion mutants of the alphaherpesvirus pseudorabies virus (PrV), which had been selected by serial passaging in cell culture. Both passaged viruses carry congruent mutations in seven genes including UL46 which encodes one of the major tegument proteins. Herpesvirus pUL46 homologs have recently been shown to activate the PI3K-Akt and ERK1/2 signaling pathways, which are involved in regulation of mitosis and apoptosis. Since in uninfected cells fragmentation of the nuclear envelope occurs during mitosis and apoptosis, we analyzed whether pUL46 of PrV is involved in signaling events impairing the integrity of the nuclear envelope. We show here that PrV pUL46 is able to induce phosphorylation of ERK1/2 and, thus, expression of ERK1/2 target genes, but fails to activate the PI3K-Akt pathway. Deletion of UL46 from PrV-UL34Pass and PrV-UL31Pass, or substitution by wild type UL46 resulted in enhanced nuclear envelope breakdown indicating that the mutations in pUL46 may limit the extent of NEBD. Thus, although pUL46 induces ERK1/2 phosphorylation, controlling the integrity of the nuclear envelope is independent of the ERK1/2 signaling pathway.

    Importance: Herpesvirus nucleocapsids can leave the nucleus by regulated, vesicle-mediated transport through the nuclear envelope designated as nuclear egress, or by inducing nuclear envelope breakdown (NEBD). The viral proteins involved in NEBD are unknown. We show here that the pseudorabies virus tegument protein pUL46 induces the ERK1/2 signaling pathway and modulates NEBD. However, these two processes are independent and ERK1/2 signaling induced by pUL46 is not involved in herpesvirus-induced NEBD.

  • Welcome from the Gems Associate Editors [PublishAheadOfPrint]

  • Welcome to Gems! We were honored to be invited to serve as the first Associate Editors of this exciting new platform for the Journal of Virology. Our goals are to highlight the "News and Views" in virology including developments from new investigators and our established colleagues, topics considered controversial or cutting-edge, new tools and resources, and opinions on areas important to the virology community as a few examples.

  • Sp100 isoform-specific regulation of human Adenovirus type 5 (Ad5) gene expression [PublishAheadOfPrint]

  • PML-NBs are nuclear structures accumulating intrinsic host factors to restrict viral infections. To ensure viral replication, these must be limited by expressing viral early regulatory proteins that functionally inhibit PML-NB-associated antiviral effects. To benefit from the activating capabilities of Sp100A and simultanously limit repression by Sp100B/C/HMG, Ads employ several features to selectively and individually target these isoforms. Adenovirus (Ad) induces relocalization of Sp100B/C/HMG from PML-NBs prior to association with viral replication centers. In contrast, Sp100A is kept at the PML tracks that surround the newly formed viral replication centers as designated sites of active transcription. We conclude that host-restriction factors Sp100B/C/HMG are potentially inactivated by active displacement from these sites, whereas Sp100A is retained to amplify Ad gene expression. Ad-dependent loss of Sp100 SUMOylation is another crucial part of the virus repertoire to counteract intrinsic immunity by circumventing Sp100 association with HP1, therefore limiting chromatin condensation. We provide evidence that Ad selectively counteracts antiviral responses, and at the same time benefits from PML-NB associated components which support viral gene expression by actively recruiting them to PML track-like structures. Our findings provide insights into novel strategies for manipulating transcriptional regulation, to either inactivate, or amplify viral gene expression.

    Importance We describe an adenoviral viral evasion strategy that involves isoform-specific and active manipulation of the PML-associated restriction factor Sp100. Recently, we reported that the adenoviral transactivator E1A targets PML-II to efficiently activate viral transcription. In contrast, PML-associated proteins Daxx and ATRX are inhibited by early viral factors. We show that this concept is more intricate and significant than originally believed, since adenoviruses apparently take advantage of specific PML-NB-associated proteins and simultaneously inhibit antiviral measures to maintain the viral infectious program. Specifically, we observed Ad-induced relocalization of the Sp100 isoforms B, C and HMG from PML-NBs juxtaposed to viral replication centers. In contrast, Sp100A is retained at Ad-induced PML tracks that surround the newly formed viral replication centers, acting as designated sites of active transcription. The host restriction factors Sp100B, C and HMG are potentially inactivated by active displacement from these sites, whereas Sp100A is retained to amplify Ad gene expression.

  • HIV-1 Vpu antagonism of tetherin inhibits antibody-dependent cellular cytotoxic responses by natural killer cells [PublishAheadOfPrint]

  • The type I IFN inducible factor tetherin retains virus particles on the surface of cells infected with vpu-deficient HIV-1. While this mechanism inhibits cell-free viral spread, the immunological implications of tethered virus have not been investigated. We found that surface tetherin expression increased the antibody opsonization of vpu-deficient HIV-infected cells. The absence of Vpu also stimulated NK cell-activating FcRIIIa signaling, enhanced NK cell degranulation and NK cell-mediated antibody dependent cellular cytotoxicity (ADCC). The deletion of vpu in HIV-1 infected primary CD4 T cells enhanced the levels of antibody binding and Fc receptor signaling mediated by HIV-positive patient-derived antibodies. The magnitude of antibody binding and Fc signaling were both highly correlated to the levels of tetherin on the surface of infected primary CD4 T cells. The affinity of antibody binding to FcRIIIa was also found to be critical in mediating efficient Fc-activation. These studies implicate Vpu antagonism of tetherin as an ADCC evasion mechanism that prevents antibody-mediated clearance of virally infected cells.

    Importance The ability of the HIV-1 accessory factor to antagonize tetherin has been considered to primarily function by limiting the spread of virus by preventing the release of cell-free virus. This study supports that a major function of Vpu is to decrease the recognition of infected cells by anti-HIV antibodies at the cell surface, thereby reducing recognition by antibody dependent clearance by natural killer cells.

  • An Epistatic Relationship Between the Viral Protein Kinase UL97 and the UL133-UL138 Latency Locus During the Human Cytomegalovirus Lytic Cycle. [PublishAheadOfPrint]

  • We report that UL133-UL138 (UL133/8), a transcriptional unit within the ULb' region (ULb') of the human cytomegalovirus (HCMV) genome, and UL97, a viral protein kinase encoded by HCMV, play epistatic roles in facilitating progression of the viral lytic cycle. In studies with HCMV strain TB40/E, pharmacological blockade or genetic ablation of UL97 significantly reduced levels of mRNA and protein for IE2 and viral early and early-late genes during a second wave of viral gene expression that commenced between 24 and 48 hours post infection. These effects were accompanied by significant defects in viral DNA synthesis and viral replication. Interestingly, deletion of UL133/8 likewise caused significant defects in viral DNA synthesis, viral gene expression, and viral replication, which were not exacerbated upon UL97 inhibition. When UL133/8 was restored to HCMV laboratory strain AD169, which otherwise lacks the locus, the resulting recombinant virus replicated similarly to parental virus. However, during UL97 inhibitor treatment, the UL133/8-restored virus showed significantly exacerbated defects in viral DNA synthesis, viral gene expression and production of infectious progeny virus, thus recapitulating the differences between wild-type TB40/E and its UL133/8 null derivative. Phenotypic evaluation of mutants null for specific open reading frames within UL133/8 revealed a role for UL135 in promoting viral gene expression, viral DNA synthesis and viral replication, which depended on UL97. Taken together, our findings suggest that UL97 and UL135 play interdependent roles in promoting the progression of a second phase of the viral lytic cycle, and that these roles are crucial for efficient viral replication.

    IMPORTANCE A unique feature of the herpesviruses, such as human cytomegalovirus (HCMV), is that they can undergo latency, a state during which the virus silences its gene expression, which allows for lifelong viral persistence in immunocompetent hosts. We have uncovered an unexpected link between a cluster of HCMV genes involved in latency, UL133-UL138, and a virally encoded protein kinase, UL97, which plays crucial roles in manipulating the cell cycle during HCMV lytic replication. Although viral immediate-early (IE) gene expression is essential for HCMV lytic replication, the activation of IE gene expression in latently infected cells is not sufficient to result in production of infectious virus. Our findings here, and in an accompanying study, show that proteins expressed from the UL133-UL138 latency locus and UL97 play interdependent roles in overcoming checkpoints that restrict the viral lytic replication cycle, which suggests intriguing implications for establishment of and reactivation from HCMV latency.

  • The C-terminal repeat domains of nsP3 from the Old World alphaviruses bind directly to G3BP [PublishAheadOfPrint]

  • The Old World alphaviruses block stress granule assembly by sequestration of RasGAP SH3-domain-binding protein (G3BP). Here we show that the proline-rich sequences in the hypervariable domain of non-structural protein (nsP) 3 of both Semliki Forest virus and Chikungunya virus were dispensable for binding to G3BP. nsP3 variants with or without this domain colocalized with G3BP. Furthermore, we show that the C-terminal repeat motifs of nsP3 were sufficient for G3BP binding.

  • Envelope proteins derived from naturally integrated hepatitis B virus DNA support assembly and release of infectious hepatitis delta virus particles. [PublishAheadOfPrint]

  • A natural subviral agent of human hepatitis B virus (HBV), hepatitis delta virus (HDV) requires only the envelope proteins from HBV in order to maintain persistent infection. HBV surface antigens (HBsAgs) can be produced either by HBV replication, or from integrated HBV DNA regardless of the replication. The functional properties of the integrant-generated HBsAgs were examined using two human HCC-derived cell lines Hep3B and PLC/PRF/5 that contain HBV integrants, but do not produce HBV virions and have no signs of HBV replication. Both cell lines were able to support HDV replication, and assembly/egress of HDV virions. Neither of the cell lines was able to produce substantial amounts of the PreS1-containing HDV particles. HDV virions assembled in PLC/PRF/5 cells were able to infect primary human hepatocytes, while Hep3B-derived HDV appeared non-infectious. These results correlate with the findings that the entire open reading frame (ORF) for the large (L) envelope protein that is essential for infectivity was present on HBV RNAs from PLC/PRF/5 cells, while the L ORF that was truncated and fused to inverted pre-core sequences was found using RNAs from Hep3B cells. This study demonstrated for the first time that at least some of HBV DNA sequences naturally integrated during infection can produce functional small and large envelope proteins capable of the formation of infectious HDV virions. Our data indicated that in vivo chronic HDV infection can persist in the absence of HBV replication (or when HBV replication is profoundly suppressed) if functional envelope proteins are supplied from HBV integrants.

    IMPORTANCE The study addresses the unique mechanism of HDV persistence in the absence of ongoing HBV replication; advances our understanding of HDV-HBV interactions; and supports the implementation of treatments directly targeting HDV for HDV/HBV-infected individuals.

  • Kinetic and structural analysis of coxsackievirus B3 receptor interactions and formation of the A-particle [PublishAheadOfPrint]

  • The coxsackievirus and adenovirus receptor (CAR) has been identified as the cellular receptor for group B coxsackieviruses, including serotype 3 (CVB3). CAR mediates infection by binding to CVB3 and catalyzing conformational changes in the virus that result in formation of the altered, non-infectious "A-particle". Kinetic analyses show that the apparent first-order rate constant for the inactivation of CVB3 by soluble CAR (sCAR) at physiological temperatures varies non-linearly with sCAR concentration. The cryo-electron microscopy (cryo-EM) reconstruction of the CVB3-CAR complex resulted in a 9.0 AAring; resolution map that was interpreted with the four available crystal structures of CAR, providing a consensus footprint for the receptor-binding site. The analysis of the cryo-EM structure identifies important virus-receptor interactions that are conserved across picornavirus species. These conserved interactions map to variable antigenic sites or structurally conserved regions, suggesting a combination of evolutionary mechanisms for receptor site preservation. The CARnndash;catalyzed A-particle structure was solved to 6.6 AAring; resolution and shows significant rearrangement of internal features and symmetric interactions with the RNA genome.

    Statement of Importance Our manuscript presents new information about receptor use by picornaviruses and highlights the importance of attaining at least ~9 AAring; resolution for the interpretation of cryoEM complex maps. The analysis of receptor binding elucidates two complementary mechanisms for preservation of the low affinity (initial) interaction of receptor and defines the kinetics of receptor catalyzed conformational change to the A-particle.

  • Attenuation of Human Enterovirus 71 High Replication Fidelity Variants in AG129 Mice [PublishAheadOfPrint]

  • In a screen for ribavirin resistance, a novel high fidelity variant of human enterovirus 71 (EV71) with a single amino acid change L123F in its RNA-dependent RNA polymerase (RdRp or 3D) was identified. Based on the crystal structure of EV71 RdRp, L123 locates at the entrance of the RNA template binding channel which might form a fidelity checkpoint. EV71 RdRp-L123F variants generated less progeny in guanidine resistance assay and virus populations with lower mutation frequency in cell culture passage due to their higher replication fidelity. However, compared with wild type viruses, they did not show growth defects. In vivo infections further revealed that high fidelity mutations L123F and G64R (previously reported) negatively impacted EV71 fitness and greatly reduced viral pathogenicity alone or together in AG129 mice. Interestingly, a variant with double mutations RG/B4-G64R,L123F showed higher fidelity in vitro and less virulence in vivo than any one of above two single mutants. Its 50% lethal dose (LD50) increased more than 500 times when compared with the LD50 of wild type RG/B4 in mice. These results indicated that these high fidelity variants exhibited attenuated pathogenic phenotype in vivo and implied a promising live attenuated EV71 vaccine.

    Importance The error-prone nature of RNA dependent RNA polymerase (RdRp) of RNA viruses during replication results quasispecies and aids survival of virus population in a wide range of selective pressures. Virus variants with higher replication fidelity exhibit lower genetic diversity and attenuated pathogenicity in vivo. Here, we identified a novel high fidelity mutation L123F in the RdRp of human enterovirus 71 (EV71). We further elucidated that EV71 variants with RdRp-L123F and/or previously identified high fidelity mutation RdRp-G64R were attenuated in AG129 mice model. As EV71 has emerged as a serious worldwide health threat, especially in developing countries in Asia-Pacific region, we urgently need EV71 vaccines. Learning from the poliovirus vaccination, we prefer live attenuated EV71 vaccines to inactivated EV71 vaccines in order to effectively control EV71 outbreaks at low cost. Our results imply a new means of attenuating EV71 and reducing its mutation rate at the same time.

  • The 5' untranslated region of the human T-cell lymphotropic virus type 1 mRNA enables cap-independent translation initiation [PublishAheadOfPrint]

  • The human T-cell leukemia virus type 1 (HTLV-1) is a complex human retrovirus that causes adult T cell leukemia and of HTLV-associated myelopathy/tropical spastic paraparesis. The mRNA of some complex retroviruses including the human and simian immunodeficiency viruses, HIV and SIV, can initiate translation using a canonical cap-dependent mechanism or though an internal ribosome entry site (IRES). In this study we present strong evidence showing that like HIV-1 and SIV, the 5rrsquo; untranslated region of the HTLV-1 full-length mRNA harbors an IRES. Cap-independent translational activity was evaluated and demonstrated using dual luciferase bicistronic mRNAs in rabbit reticulocyte lysate, in mammalian cell culture, and in Xenopus laevis oocytes. Characterization of the HTLV-1 IRES shows that its activity is dependent on the ribosomal protein S25 (RPS25) and that its function is highly sensitive to the drug edeine. Together, these findings suggest that the 5rrsquo; UTR of the HTLV-1 full length mRNA enables internal recruitment of the eukaryotic translation initiation complex. However, the recognition of the initiation codon requires ribosome scanning. These results suggest that after internal recruitment by the HTLV-1 IRES a scanning step takes place for the 40S ribosomal subunit to be positioned at the translation initiation codon.

    IMPORTANCE: The mechanism by which retroviral mRNAs recruit the 40S ribosomal subunit internally is not understood. This study provides new insights into the mechanism of translation initiation used by the human T-cell lymphotropic virus type 1 (HTLV-1). Results show that the HTLV-1 mRNA can initiate translation via a non-canonical mechanism mediated by an internal ribosome entry site (IRES). This study also provides evidence showing the involvement of cellular proteins in HTLV-1 IRES-mediated translation initiation. Together the data presented in this report significantly contribute to the understanding of HTLV-1 gene expression.

  • The amphibian (Xenopus laevis) type I interferon response to Frog Virus 3: new insight into ranavirus pathogenicity [PublishAheadOfPrint]

  • Increasing prevalence of ranavirus (RV; Iridoviridae) infections of wild and commercially maintained aquatic species is raising considerable concerns. While Xenopus laevis is the leading model for immune-RV studies, amphibian antiviral interferon responses remain largely uncharacterized. Accordingly, a X. laevis type I interferon was identified, the expression of this gene was examined in RV (Frog Virus 3, FV3) infected tadpoles and adult frogs by quantitative PCR and a recombinant form of this molecule (rXlIFN) was produced for the purpose of functional studies. This rXlIFN protected the kidney-derived A6 cell line and tadpoles against FV3 infections, decreasing infectious viral burdens in both cases. Adult frogs are naturally resistant to FV3 and clear infections within a few weeks, whereas tadpoles typically succumb to this virus. Hence as predicted, virally infected adult X. laevis exhibited significantly more robust FV3-elicited IFN gene expression than tadpoles, nevertheless they also tolerated substantially greater viral burdens following infection. Although tadpole stimulation with rXlIFN prior to FV3 challenge markedly impaired viral replication and viral burdens, it only transiently extended tadpole survival without preventing the eventual mortality of these animals. Furthermore, histological analysis revealed that despite rXlIFN treatment, infected tadpoles had considerable organ damage including disrupted tissue architecture and extensive necrosis and apoptosis. Conjointly, these findings indicate a critical protective role for the amphibian type I IFN response during ranaviral infections and suggest that these viruses are more pathogenic to tadpole hosts than previously believed, causing extensive and fatal damage to multiple organs, even at very low titers.

    IMPORTANCE Ranavirus infections are threatening wild and commercially maintained aquatic species. The amphibian Xenopus laevis is extensively utilized as an infection model for studying ranavirus-host immune interactions. However, little is known about amphibian antiviral immunity and specifically type I interferons (IFNs), which are central to antiviral defenses of other vertebrates. Accordingly, we identified and characterized a X. laevis type I interferon in the context of the ranavirus Frog Virus 3 (FV3) infections. FV3-infected adult frogs displayed more robust IFN gene expression than tadpoles, possibly explaining why they typically clear FV3 infections whereas tadpoles succumb to them. Pretreatment with a recombinant IFN (rXlIFN) substantially reduced viral replication and infectious viral burdens in a frog kidney cell line and in tadpoles. Despite reducing FV3 loads and extending mean survival, rXlIFN treatments failed to prevent tadpole tissue damage and mortality. Thus, FV3 is more pathogenic than previously believed, even at very low titers.

  • Reinitiation after Translation of Two Upstream Open Reading Frames Governs Expression of the ORF35-37 KSHV Polycistronic mRNA [PublishAheadOfPrint]

  • The Kaposi's sarcoma-associated herpesvirus (KSHV) ORF36 protein kinase is translated as a downstream gene from the ORF35-37 polycistronic mRNA via a unique mechanism involving short upstream open reading frames (uORFs) located in the 5rrsquo; untranslated region. Here, we confirm that ORF35-37 is functionally dicistronic during infection and demonstrate that mutation of the dominant uORF restricts KSHV replication. Leaky scanning past the uORFs facilitates ORF35 expression, while a reinitiation mechanism after the uORFs enables ORF36 translation.

  • Association between Cellular Immune Activation, Target Cell Frequency, and Risk of Human Immunodeficiency Virus Type-1 Superinfection [PublishAheadOfPrint]

  • We performed a case-control study of women at risk of HIV-1 superinfection to understand the relationship between immune activation and HIV-1 acquisition. An increase in the frequency of HIV-1 target cells, but not in other markers of T cell activation, was associated with a 1.7-fold increase in the odds of superinfection. This suggests that HIV-1 acquisition risk is influenced more by the frequency of target cells than by the generalized level of immune activation.

  • Identification of Cellular Proteins Interacting with the Retroviral Restriction Factor SAMHD1 [PublishAheadOfPrint]

  • Human and mouse SAMHD1 proteins block HIV-1 infection in non-cycling human monocytic cells by reducing the intracellular dNTP concentrations. Phosphorylation of human SAMHD1 at threonine 592 (T592) by cyclin dependent kinase 1 (CDK1) and cyclin A2 impairs its HIV-1 restriction activity, but not the dNTP hydrolase activity, suggesting that dNTP depletion is not the sole mechanism of SAMHD1-mediated HIV-1 restriction. Using co-immunoprecipitation and mass spectrometry, we identified and validated two additional host proteins interacting with human SAMHD1, namely, cyclin dependent kinase 2 (CDK2) and S-phase kinase-associated protein 2 (SKP2). We observed that mouse SAMHD1 specifically interacted with cyclin A2, cyclin B1, CDK1, and CDK2. Given the role of these SAMHD1-interacting proteins in cell cycle progression, we investigated the regulation of these host proteins by monocyte differentiation and activation of CD4+ T-cells and examined their effect on the phosphorylation of human SAMHD1 at T592. Our results indicate that primary monocyte differentiation and CD4+ T-cell activation regulate the expression of these SAMHD1-interacting proteins. Furthermore, our results suggest that, in addition to CDK1 and cyclin A2, CDK2 phosphorylates T592 of human SAMHD1 and thereby regulates its HIV-1 restriction function.

    IMPORTANCE SAMHD1 is the first dNTP triphosphohydrolase found in mammalian cells. Human and mouse SAMHD1 proteins block HIV-1 infection in non-cycling cells. Previous studies suggested that phosphorylation of human SAMHD1 at threonine 592 by CDK1 and cyclin A2 negatively regulates its HIV-1 restriction activity. However, it is unclear whether human SAMHD1 interacts with other host proteins in the cyclin A2 and CDK1 complex and whether mouse SAMHD1 shares similar cellular interacting partners. Here we identify five cell cycle-related host proteins that interact with human and mouse SAMHD1, including three previously unknown cellular proteins (CDK2, cyclin B1, and SKP2). Our results demonstrate that several SAMHD1-interacting cellular proteins regulate phosphorylation of SAMHD1 and play an important role in HIV-1 restriction function. Our findings help define the role of these cellular interacting partners of SAMHD1 that regulate its HIV-1 restriction function.

  • The Emergence and Evolution of Avian H5N2 Influenza viruses in Chickens in Taiwan [PublishAheadOfPrint]

  • Sporadic activity by H5N2 influenza viruses has been observed in chickens in Taiwan from 2003 to 2012. The available information suggests that these viruses were generated by reassortment between a Mexican-like H5N2 and a local enzootic H6N1 virus. Yet, the origin, prevalence and pathogenicity of these H5N2 viruses have not been fully defined. Following the 2012 highly pathogenic avian influenza (HPAI) outbreaks, surveillance was conducted from December 2012 to July 2013 at a live-poultry wholesale market in Taipei. Our findings showed that H5N2 and H6N1 viruses co-circulated at low-levels in chickens in Taiwan. Phylogenetic analyses revealed that all H5N2 viruses had hemagglutinin (HA) and neuraminidase (NA) genes derived from a 1994 Mexican-like virus, while their internal gene complexes were incorporated from the enzootic H6N1 virus lineage by multiple reassortment events. Pathogenicity studies demonstrated heterogeneous results, even though all tested viruses had motifs (R-X-K/R-R) supportive of high pathogenicity. Serological surveys for common subtypes of avian viruses confirmed the prevalence of the H5N2 and H6N1 viruses in chickens and revealed an extraordinarily high seroconversion rate to an H9N2 virus, a subtype that is not found in Taiwan but is prevalent in Mainland China. These findings suggest that reassortant H5N2, together with H6N1, viruses have become established and enzootic in chickens throughout Taiwan and that a large-scale vaccination program might have been conducted locally, which likely led to the introduction of the 1994 Mexican-like virus to Taiwan in 2003.

    IMPORTANCE H5N2 avian influenza viruses first appeared in chickens in Taiwan in 2003 and caused a series of outbreaks afterwards. Phylogenetic analyses show that the chicken H5N2 viruses have H5 and N2 genes that are closely related to those of a vaccine strain originating from Mexico in 1994, while the contemporary duck H5N2 viruses in Taiwan belong to the Eurasian gene pool. The unusually high similarity of the chicken H5N2 viruses to the Mexican vaccine strain suggests that these viruses might be introduced to Taiwan by using inadequately inactivated or attenuated vaccine. These chicken H5N2 viruses are developing a variety of pathogenicity that could lead to significant consequence to the local poultry industry. These findings emphasize the need for strict quality control and competent oversight in the manufacture and usage of avian influenza virus vaccines, and alternatives to widespread vaccination may be desirable.

  • High rates of infection with novel enterovirus variants in wild populations of mandrills and other Old World Monkey species [PublishAheadOfPrint]

  • Enteroviruses (EVs) are a genetically and antigenically diverse group of viruses infecting humans. A mostly distinct set of EV variants have additionally been documented to infect wild apes and several, primarily captive, Old World monkey (OWM) species. To investigate the prevalence and genetic characteristics of EVs infecting OWMs in the wild, faecal samples from mandrills (Mandrillus sphinx) and other species collected in remote regions of Southern Cameroon were screened for EV RNA. Remarkably high rates of EV positivity were detected in M.sphinx (100 from 102 screened), Cercocebus torquatus (7/7) and Cercopithecus cephus (2/4), with high viral loads indicative of active infection. Genetic characterisation in VP4/VP2 and VP1 regions allowed EV variants to be assigned to simian species H (EV-H), EV-J (including one or more new types) while seven matched simian EV-B variants, SA5 and EV110 (chimpanzee). Sequences from the remaining 70 formed a new genetic group distinct in VP4/2 and VP1 region from all currently recognised human or simian EV species. Complete genome sequences were obtained from three to determine their species assignment. In common with EV-J and the EV-A A13 isolate, new group sequences were chimaeric, being most closely related to EV-A in capsid genes and to EV-B in the non-structural gene region. Further recombination events created different groupings in 5rrsquo; and 3rrsquo; untranslated regions. While clearly a distinct EV group, the hybrid nature of new variants prevented their unambiguous classification as either members of a new species or as divergent members of EV-A using current ICTV assignment criteria.

    IMPORTANCE This study is the first large scale investigation of the frequency of infection and diversity of enteroviruses (EVs) infecting monkeys (primarily mandrills) in the wild. Findings demonstrate extremely high frequencies of active infection (95%) among mandrills and other Old World monkey species inhabiting remote regions of Cameroon without human contact. EV variants detected were distinct from those infecting human populations, comprising members of enterovirus species B, J and H and a large novel group of viruses that potentially represent a candidate new EV species. The viral sequences obtained contribute substantially to our growing understanding of the genetic diversity of EVs and the existence of inter-species chimaerism that characterises the novel variants in the current study, as well as in previously characterised species A and J viruses infecting monkeys. The latter findings will contribute to future development of consensus criteria for species assignments in enteroviruses and other picornavirus genera.

  • The NSs protein of Tomato spotted wilt virus is required for persistent infection and transmission by Frankliniella occidentalis [PublishAheadOfPrint]

  • Tomato spotted wilt virus (TSWV) is the type member of tospoviruses (genus Tospovirus), plant-infecting viruses that cause severe damage to ornamental and vegetable crops. Tospoviruses are transmitted by thrips in the circulative propagative mode. We generated a collection of NSs-defective TSWV isolates and showed that TSWV coding for truncated NSs protein could not be transmitted by Frankliniella occidentalis. Quantitative reverse transcription (RT)-PCR and immuno-staining of individual insects detected the mutant virus in second-instar larvae and adult insects, demonstrating that insects could acquire and accumulate the NSs-defective virus. Nevertheless, adults carried a significantly lower viral load, resulting in the absence of transmission. Genome sequencing and analyses of reassortant isolates showed genetic evidence of the association between the loss of competence in transmission and the mutation in the NSs coding sequence. Our findings offer a new insight into the TSWV-thrips interaction and Tospovirus pathogenesis and highlight, for the first time in the Bunyaviridae family, a major role of the S segment, and specifically for the NSs protein, in virulence and efficient infection in insect vector individuals.

    Importance statement: our work is the first to show a role of the NSs protein in virus accumulation in the insect vector in the Bunyaviridae family: demonstration was obtained for the system TSWV-F. occidentalis, arguably one of the most damaging combination for vegetable crops. Genetic evidence of the involvement of the NSs protein in vector transmission was provided with multiple approaches.

  • Quantification of deaminase activity-dependent and -independent restriction of HIV-1 replication mediated by APOBEC3F and APOBEC3G through experimental-mathematical investigation [PublishAheadOfPrint]

  • APOBEC3F and APOBEC3G cytidine deaminases potently inhibit HIV-1 replication by enzymatically inserting G-to-A mutations in viral DNA and/or impairing viral reverse transcription independently of their deaminase activity. Through experimental-mathematical investigation, here we quantitatively demonstrate that 99.3% of anti-viral effect of APOBEC3G is dependent on its deaminase activity, whereas 30.2% of anti-viral effect of APOBEC3F is attributed to deaminase-independent ability. This is the first report quantitatively elucidating how APOBEC3F and APOBEC3G differ in their anti-HIV-1 modes.

  • Coronavirus Replicase-Reporter Fusions Provide Quantitative Analysis of Replication and Replication Complex Formation [PublishAheadOfPrint]

  • The replication of coronaviruses occurs in association with multiple virus-induced membrane structures that evolve during the course of infection; however, the dynamics of this process remain poorly understood. Previous studies of coronavirus replication complex organization and protein interactions have utilized protein overexpression studies and immunofluorescence of fixed cells. Additionally, live imaging studies of coronavirus replicase proteins have used fluorescent reporter molecules fused to replicase proteins, but expressed from non-native locations, mostly late-transcribed subgenomic mRNAs, in the presence or absence of the native protein. Thus, the timing of and targeting of native replicase proteins expressed in real time from native locations in the genome remain unknown. In this study, we tested whether reporter molecules could be expressed from the replicase polyprotein of murine hepatitis virus as fusions with nonstructural proteins 2 or 3, and whether such reporters could define targeting and activity of replicase proteins during infection. We demonstrate that fusion of green fluorescent protein and firefly luciferase with either nonstructural protein 2 or 3 is tolerated and that these reporter-replicase fusions can be used to quantitate replication complex formation and virus replication. The results show that the replicase gene has flexibility to accommodate foreign gene addition and can be used directly to study replicase complex formation and evolution during infection, as well as to provide highly sensitive and specific markers for protein translation and genome replication.

    Importance Coronaviruses are a family of enveloped, positive-sense RNA viruses that are important agents of disease, including Severe Acute Respiratory Syndrome Coronavirus and Middle East Respiratory Syndrome Coronavirus. Replication is associated with multiple virus-induced membrane structures that evolve during infection; however the dynamics of this process remain poorly understood. In this study, we tested whether reporter molecules expressed from native locations within the replicase polyprotein of murine hepatitis virus as fusions with nonstructural proteins could define the expression and targeting of replicase proteins during infection in live cells. We demonstrate that the replicase gene tolerates introduction of green fluorescent protein or firefly luciferase as fusions with replicase proteins. These viruses allow early quantitation of virus replication as well as real time measurement of the replication complexes.

  • A template role of double-stranded RNA in tombusvirus replication [PublishAheadOfPrint]

  • Replication of plus-strand RNA viruses of plants is a relatively simple process that involves complementary (-)RNA synthesis and subsequent (+)RNA synthesis. However, the actual replicative form of the (-)RNA template in case of plant (+)RNA viruses is not yet established unambiguously. In this paper, using a cell-free replication assay supporting full cycle of viral replication, we show that replication of Tomato bushy stunt virus (TBSV) leads to the formation of double-stranded (ds)RNA. Using ribonuclease digestion, DNAzyme, and RNA mobility-shift assays, we demonstrate the absence of naked (-)RNA templates during replication. Time course experiments showed the rapid appearance of dsRNA earlier than the bulk production of new (+)RNAs, suggesting an active role for dsRNA in replication. Radioactive nucleotide chase experiments showed that the mechanism of TBSV replication involves the use of dsRNA templates in strand displacement reaction, where the newly synthesized (+)strand replaces the original (+)strand RNA in the dsRNA. We propose that the use of dsRNA as a template for (+)RNA synthesis by the viral replicase is facilitated by recruited host DEAD-box helicases and the viral p33 RNA chaperone protein. Altogether, this replication strategy allows TBSV to separate (-) and (+)-strand synthesis in time and regulate asymmetrical RNA replication that leads to abundant (+)RNA progeny.

    Importance Positive-stranded RNA viruses of plants use their RNAs as templates for replication. First, (-)-strand is synthesized by the viral replicase complex (VRC), which then serves as a template for new (+)-strand synthesis. To characterize the nature of the (-)RNA in the membrane-bound viral replicase, the authors performed complete RNA replication of Tomato bushy stunt virus (TBSV) in yeast cell-free extracts and in plant extracts. The experiments demonstrated that the TBSV (-)RNA is present as a double-stranded RNA that serves as template for TBSV replication. During the production of the new (+)-strands, the viral replicase displaces the old (+)-strand in the dsRNA template, leading to asymmetrical RNA synthesis. The presented data are in agreement with a model that the dsRNA is present in a nuclease-resistant membranous VRCs. This strategy likely allows TBSV to protect the replicating viral RNA from degradation as well as to evade the early detection of viral dsRNAs by the host surveillance system.

  • Novel permissive cell lines for a complete propagation of hepatitis C virus [PublishAheadOfPrint]

  • Hepatitis C virus (HCV) is a major etiologic agent of chronic liver diseases. Although the HCV lifecycle has been clarified by studying laboratory strains of HCV derived from the genotype 2a JFH-1 strain (HCVcc), the mechanisms of particle formation have not been elucidated. Recently, we showed that exogenous expression of a liver-specific microRNA, miR-122, in nonhepatic cell lines facilitates efficient replication but not particle production of HCVcc, suggesting that liver-specific host factors are required for infectious particle formation. In this study, we screened human cancer cell lines for expression of the liver-specific aalpha;-fetoprotein by using a cDNA array database, and identified liver-derived JHH-4 cells and stomach-derived FU97 cells, which express liver-specific host factors comparable to Huh7 cells. These cell lines permit not only replication of HCV RNA, but also particle formation upon infection with HCVcc, suggesting that hepatic differentiation participates in the expressions of liver-specific host factors required for HCV propagation. HCV inhibitors targeting host and viral factors exhibited different antiviral efficacies between Huh7 and FU97 cells. Furthermore, FU97 cells exhibited higher susceptibility for propagation of HCVcc derived from the JFH-2 strain than Huh7 cells. These results suggest that hepatic differentiation participates in the expression of liver-specific host factors required for a complete propagation of HCV.

    IMPORTANCE Previous studies have shown that liver-specific host factors are required for efficient replication of HCV RNA and formation of infectious particles. In this study, we screened human cancer cell lines for expression of the liver-specific aalpha;-fetoprotein by using a cDNA array database, and identified novel permissive cell lines for a complete propagation of HCVcc without any artificial manipulation. In particular, gastric cancer-derived FU97 cells exhibited a much higher susceptibility to HCVcc/JFH-2 infection than was observed in Huh7 cells, suggesting that FU97 cells would be useful for further investigation of the HCV lifecycle, as well as the development of therapeutic agents for chronic hepatitis C.

  • Depletion of the cdk inhibitor p16INK4a differentially affects proliferation of established cervical carcinoma cells [PublishAheadOfPrint]

  • Infections with high-risk human papillomaviruses (hrHPV) contribute to cervical carcinoma. The cdk inhibitor and tumor suppressor p16INK4A is consistently upregulated in cervical carcinoma cells for reasons that are poorly understood. We report here that downregulation of p16INK4Agene expression in three different cervical carcinoma cell lines reduced expression of the E7 oncogene, suggesting a positive feedback loop involving E7 and p16INK4A. p16INK4A depletion induced cellular senescence in HeLa but not CaSki and MS-751 cervical carcinoma cells.

    Importance: This study demonstrates that the cdk inhibitor p16INK4A, frequently used as surrogate marker for transforming infections by human papillomaviruses of the high-risk group, is required for high level expression of the E7 oncoproteins of HPV-16, HPV-18 and HPV-45 in cervical carcinoma cells. It is also demonstrated that depletion of p16INK4A induces senescence in HeLa but not CaSki or MS-751 cervical carcinoma cells.

  • VP08R from the infectious spleen and kidney necrosis virus is a novel component of virus-mock basement membrane [PublishAheadOfPrint]

  • Infectious spleen and kidney necrosis virus (ISKNV), the type species of the genus Megalocytivirus, family Iridoviridae, brings great harm to fish farming. In infected tissues, ISKNV infection is characterized by a unique phenomenon in that the infected cells are attached with lymphatic endothelial cells (LECs), which are speculated to wall off the infected cells from host immune attack. A membrane viral protein VP23R binds and recruits the host nidogen-1 protein to construct a basement membrane-like structure termed virus-mock basement membrane (VMBM) on the surface of infected cells to provide attaching sites for LECs. VMBMs do not contain collagen IV protein, which is essential for maintenance of the BM integrity and functions. In this study, we identified the VP08R protein encoded by ISKNV. VP08R was predicted to be a secreted protein with a signal peptide but without a transmembrane domain. However, immunofluorescence assays demonstrated that VP08R was located on the plasma membrane of infected cells and showed a similar expression profile to that of VP23R. Co-immunoprecipitation showed that VP08R interacted with both VP23R and nidogen-1, indicating that VP08R is a component of VMBM and is present on the cell membrane by binding to VP23R. Through formation of intermolecular disulfide bonds, VP08R molecules self-organized into a multimer, which may play a role in maintenance of VMBM integrity and stability. Moreover, the VP08R multimer was easily degraded when the ISKNV-infected cells were lysed, which may be a mechanism for VMBM disassembly when necessary to free LECs and release the mature virions.

    Importance Infectious spleen and kidney necrosis virus (ISKNV, genus Megalocytivirus, family Iridovirus) is most harmful to cultured fishes. In tissues, the ISKNV-infected cells are attached with lymphatic endothelial cells (LECs), which are speculated to segregate the host immune system. A viral membrane protein VP23R binds and recruits host nidogen-1 protein to construct virus-mock basement membranes (VMBMs) on the surface of infected cells to provide attaching sites for LECs. Although VMBMs lack the collagen IV network, which is an essential structural part of true BMs, VMBMs still show an intact structure. An ISKNV-encoded VP08R protein can self-assemble to a multimer and bind both VP23R and nidogen-1 to maintain the integrity and stability of VMBMs. Based on these, we redrew the putative schematic illustration of VMBM. Our study suggests a virus adopts a strategy to remodel the cellular matrix, and may provide an important reference to elucidate BM functions and lymphangiogenesis mechanisms.

  • Functional evidence for the involvement of microtubules and dynein motor complexes in TRIM5{alpha}-mediated restriction of retroviruses [PublishAheadOfPrint]

  • The tripartite motif (TRIM) family of proteins includes the TRIM5aalpha; antiretroviral restriction factor. TRIM5aalpha; from many Old World and some New World monkeys can restrict the human immunodeficiency virus type 1 (HIV-1), while human TRIM5aalpha; restricts N-tropic Murine Leukemia Virus (N-MLV). TRIM5aalpha; forms highly dynamic cytoplasmic bodies (CBs) that associate with and translocate on microtubules. However, the functional involvement of microtubules or other cytoskeleton-associated factors in the viral restriction process had not been shown. Here, we demonstrate the dependency of TRIM5aalpha;-mediated restriction on microtubule-mediated transport. Pharmacological disruption of the microtubule network using nocodazole or disabling it using taxol decreased restriction of N-MLV and HIV-1 by human or simian alleles of TRIM5aalpha;, respectively. In addition, pharmacological inhibition of dynein motor complexes using erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA) and siRNA-mediated depletion of the dynein heavy chain (DHC) similarly decreased TRIM5aalpha;-mediated restriction. The loss in restriction resulting from either the disassembly of microtubules or the disruption of dynein motor activity was seen for both endogenous and over-expressed TRIM5aalpha; and was not due to differences in protein stability or cell viability. Both nocodazole treatment and DHC depletion interfered with the dynamics of TRIM5aalpha; CBs, increasing their size and altering their intracellular localization. In addition, nocodazole, taxol and DHC depletion were all found to increase the stability of HIV-1 cores in infected cells, providing an alternative explanation for the decreased restriction. In conclusion, association with microtubules and the translocation activity of dynein motor complexes are required to achieve efficient restriction by TRIM5aalpha;.

    Importance The primate innate cellular defenses against infection by retroviruses include a protein named TRIM5aalpha;, belonging to the family of restriction factors. TRIM5aalpha; is present in the cytoplasm where it can intercept incoming retroviruses shortly after their entry. How TRIM5aalpha; manages to be present at the appropriate subcytoplasmic location to interact with its target is unknown. We hypothesized that TRIM5aalpha;, either as a soluble protein or a high-molecular-weight complex (the cytoplasmic body) is transported within the cytoplasm by a molecular motor called the dynein complex, itself known to interact with and move along microtubules. Our results show that destructuring microtubules or crippling their function decreased the capacity of human or simian TRIM5aalpha; to restrict their retroviral targets. Inhibiting dynein motor activity, or reducing the expression of a key component of this complex, similarly affected TRIM5aalpha;-mediated restriction. Thus, we have identified specific cytoskeleton structures involved in innate antiretroviral defenses.

  • The host protease TMPRSS2 plays a major role for in vivo replication of emerging H7N9 and seasonal influenza viruses [PublishAheadOfPrint]

  • Proteolytic cleavage of the hemagglutinin (HA) protein is essential for influenza A virus (IAV) to acquire infectivity. This process is mediated by a host cell protease(s) in vivo. The type II transmembrane serine protease TMPRSS2 is expressed in the respiratory tract and capable of activating a variety of respiratory viruses, including low-pathogenic (LP) IAVs possessing a single arginine residue at the cleavage site. Here we show that TMPRSS2 plays an essential role in the proteolytic activation of LP IAVs, including a recently emerging H7N9 subtype, in vivo. We generated TMPRSS2 knockout (KO) mice. The TMPRSS2 KO mice showed normal reproduction, development, and growth phenotypes. In TMPRSS2 KO mice infected with LP IAVs, cleavage of HA was severely impaired, and consequently the majority of LP IAV progeny particles failed to gain infectivity, while the viruses were fully activated proteolytically in TMPRSS2+/+ wild-type (WT) mice. Accordingly, in contrast to WT mice, TMPRSS2 KO mice were highly tolerant of challenge infection by LP IAVs (H1N1, H3N2, and H7N9) with gge;1,000 LD50 for WT mice. On the other hand, a high-pathogenic H5N1 subtype IAV possessing a multi-basic cleavage site was successfully activated in the lungs of TMPRSS2 KO mice and killed these mice, as observed for WT mice. Our results demonstrate that recently emerging H7N9 as well as seasonal IAVs mainly use the specific protease TMPRSS2 for HA cleavage in vivo and thus TMPRSS2 expression is essential for IAV replication in vivo.

  • Combined adenovirus vector and hepatitis C virus envelope protein prime-boost regime elicits T cell and neutralizing antibody immune responses [PublishAheadOfPrint]

  • Despite the recent progress in the development of new anti-viral agents, hepatitis C virus (HCV) infection remains a major global health problem and there is a need for a preventive vaccine. We previously reported that adenoviral vectors expressing HCV non-structural proteins elicit protective T-cell responses in chimpanzees and were immunogenic in healthy volunteers. Furthermore, recombinant HCV E1E2 protein formulated with adjuvant MF59 induced protective antibody responses in chimpanzees and was immunogenic in humans. To develop a HCV vaccine capable of inducing both T cell and antibody responses we constructed adenoviral vectors expressing full-length and truncated E1E2 envelope glycoproteins from HCV genotype 1b. Heterologous prime-boost immunization regimes with adenovirus and recombinant E1E2 glycoprotein (genotype 1a) plus MF59 were evaluated in mice and guinea pigs. Adenovirus prime and protein boost induced broad HCV specific CD8+ and CD4+ T cell responses and functional Th1-type IgG responses. Immune sera neutralized HCVpp and a diverse panel of recombinant HCVcc strains and limited cell-to-cell HCV transmission. This study demonstrates that combining adenovirus vector with protein antigen can induce strong antibody and T cell responses that surpass immune responses achieved by either vaccine alone.

    Importance Hepatitis C virus (HCV) infection is a major health problem. Despite the availability of new direct acting anti-viral agents for treating chronic infection, an affordable preventative vaccine provides the best long-term goal for controlling the global epidemic. This study describes a new anti-HCV vaccine targeting the envelope viral proteins based on adenovirus vector and protein in adjuvant. Rodents primed with the adenovirus vaccine and boosted with the adjuvanted protein developed cross-neutralizing antibodies and potent T cell responses that surpassed immune responses achieved by either vaccine component alone. If combined with the adenovirus vaccine targeting the HCV NS antigens now under clinical testing this new vaccine might lead to a stronger and broader immune response and to a more effective vaccine to prevent HCV infection. Importantly, the described approach represents a valuable strategy for other infectious diseases where both T and B cell responses are essential for protection.

  • Adenovirus E1A recruits the hPaf1 complex to enhance transcriptional elongation. [PublishAheadOfPrint]

  • During infection by human adenovirus (HAdV), the proteins encoded by the early region 1A (E1A) gene bind and appropriate components of the cellular transcriptional machinery to activate viral early genes transcription. Previously, we identified roles for the hBre1 and the hPaf1 complexes in E1A mediated transcriptional activation of HAdV early genes. Here we show that E1A binds hBre1 directly and that this complex targets the hPaf1 complex via the Rtf1 subunit. Depletion of hPaf1 reduces E1A dependent activation of transcription from the E2e, E3 and E4 viral transcription units, and this does not result from a reduced ability of RNA polymerase II to be recruited to the promoter proximal regions of these genes. In contrast, depletion of hPaf1 reduces the occupancy of RNA polymerase II across these transcription units. This is accompanied by a reduction in H3K36 trimethylation, a histone post-translational modification associated with efficient transcriptional elongation, and a reduction in full length transcripts from these genes. Together, these results indicate that E1A uses hBre1 to recruit the hPaf1 complex in order to optimally activate viral early transcription by enhancing transcriptional elongation.

    IMPORTANCE This work provides the mechanism by which the hPaf1 complex contributes to E1A dependent activation of early gene transcription. The work also demonstrates that E1A induces gene expression by stimulating transcriptional elongation in addition to its better characterized effects on transcriptional initiation.

  • The crystal structure of a Cardiovirus RNA-dependent RNA polymerase reveals an unusual conformation of the polymerase active site [PublishAheadOfPrint]

  • Encephalomyocarditis virus (EMCV) is a member of the Cardiovirus genus within the large Picornaviridae family that includes a number of important human and animal pathogens. The RNA-dependent RNA polymerase (RdRP) 3Dpol is a key enzyme for viral genome replication. In this study, we report the X-ray structures of two different crystal forms of the EMCV RdRP determined at 2.8 and 2.15 AAring; resolution. The in vitro elongation and VPg uridylylation activities of the purified enzyme have also been demonstrated. Although the overall structure of EMCV 3Dpol is shown to be similar to the known RdRPs of other members of the Picornaviridae family, structural comparisons show a large reorganization of the active site cavity in one of the crystal forms. The rearrangement affects mainly the motif A, where the conserved residue Asp240, involved in rNTP selection and its neighbor residue, Phe239, move about 10 AAring; from its expected position, within the ribose binding pocket, towards the entrance of the rNTP tunnel. This altered conformation of motif A is stabilized by a cation- interaction established between the aromatic ring of Phe239 and the side chain of Lys56, within the fingers domain. Other contacts, involving Phe239 and different residues of motif F are also observed. The movement of motif A is connected with important conformational changes in the fingers region flanked by residues 54 to 63, harboring Lys56, and in the polymerase N-terminus. The structures determined in this work provide essential information for studies on the Cardiovirus RNA replication process and may have important implications for the development of new antivirals targeting the altered conformation of motif A.

    IMPORTANCE The Picornaviridae family is one of the largest virus families known, including many important human and animal pathogens. The RNA-dependent RNA polymerase (RdRP) 3Dpol is a key enzyme for picornavirus genome replication and a validated target for the development of antiviral therapies. Solving the X-ray structure of the first cardiovirus RdRP, the EMCV 3Dpol, we captured an altered conformation of a conserved motif in the polymerase active site (motif A), containing the aspartic acid residue involved in rNTP selection and binding. This altered conformation of motif A, interfering with the correct positioning of the rNTP substrate in the active site, is stabilized by a number of residues strictly conserved among picornaviruses. The rearrangements observed suggest that this motif A segment is a dynamic element that can be modulated by external effectors, either activating or inhibiting the enzyme activity and this type of modulation appears to be general to all picornaviruses.

  • Coronaviruses: important emerging human pathogens. [PublishAheadOfPrint]

  • The emergence of a highly pathogenic human coronavirus in the Middle East has sparked new interest in human coronaviruses around the world....

  • Analysis of host gene expression changes reveals distinct roles for the cytoplasmic domain of the Epstein-Barr virus receptor/CD21 in B-cell maturation, activation and initiation of virus infection. [PublishAheadOfPrint]

  • Epstein-Barr Virus (EBV) attachment to human CD21 on the B-cell surface initiates infection. Whether CD21 is a simple tether, or conveys vital information to the cell interior for production of host factors that promote infection of primary B-cells is controversial, as the cytoplasmic fragment of CD21 is short, though highly conserved. Ubiquity of CD21 on normal B-cells, the diversity of this population, and the well-known resistance of primary B-cells to gene transfer technologies have all impeded resolution of this question. To uncover the role(s) of the CD21 cytoplasmic domain during infection initiation, the full--length receptor (CD21=CR), a mutant lacking the entire cytoplasmic tail (CT), and the control vector (NEO) were stably expressed in two pre B-cell lines that lack endogenous receptor. Genome-wide transcriptional analysis demonstrated that stable CD21 surface expression alone (either CR or CT) produced multiple independent changes in gene expression, though both dramatically decreased class I MAGE family RNAs and upregulated genes associated with B-cell differentiation (e.g. C2TA, HLA-II, IL21R, MIC2, CD48, PTPRCAP/CD45 associated protein). Temporal analysis spanning 72 hours revealed not only CR, but also CT expressing lines initiated latency. In spite of this, the number and spectrum of transcripts altered in CR compared with CT-bearing lines at one-hour after infection further diverged. Differential modulation of immediate early cellular transcripts (e.g. c-jun, multiple histones), both novel and previously linked to CD21-initiated signaling, as well as distinct results from pathway analyses support a separate role for the cytoplasmic domain in initiation of intracellular signals.

    Importance Statement: Membrane proteins that mediate virus attachment tether virus particles to the cell surface initiating infection. In addition, upon virus interaction such proteins may transmit signals to the interior of the cell that support subsequent steps in the infection process. Herein, we show that expression of the Epstein-Barr virus B-cell attachment receptor, CD21, in B-cells that lack this receptor result in significant changes in gene expression, both before and rapidly following EBV-CD21 interaction. These changes translate into major signaling pathway alterations that are predicted to support stable infection.

  • Higher Order Structure of the Rous Sarcoma Virus SP Assembly Domain [PublishAheadOfPrint]

  • Purified retroviral Gag proteins can assemble in vitro to form immature virus-like particles (VLPs). By cryo-electron tomography, Rous sarcoma virus VLPs show an organized hexameric lattice consisting chiefly of the capsid (CA) domain, with periodic stalk-like densities below the lattice. We hypothesize that the structure represented by these densities is formed by amino acid residues immediately downstream of the folded CA, namely the short spacer peptide SP, along with a dozen flanking residues. These 24 residues comprise the SP assembly (SPA) domain, and we propose that neighboring SPA units in a Gag hexamer coalesce to form a six-helix bundle. Using in vitro assembly, alanine scanning mutagenesis, and biophysical analyses, we have further characterized the structure and function of SPA. Most of the amino acid residues in SPA could not be mutated individually without abrogating assembly, with the exception of a few residues near the N- and C-termini as well as three hydrophilic residues within SPA. We interpret these results to mean that the amino acids that do not tolerate mutations contribute to higher-order structures in VLPs. Hydrogen-deuterium exchange analyses of unassembled Gag in comparison with assembled VLPs showed strong protection at the SPA region, consistent with a higher-order structure. Circular dichroism revealed that a 29mer SPA peptide shifts from a random coil to a helix in a concentration-dependent manner. Analytical ultracentrifugation showed concentration-dependent self-association of the peptide into a hexamer. Taken together, these results provide strong evidence for the formation of a critical six-helix bundle in Gag assembly.

    Importance The structure of a retrovirus like HIV is created by several thousand molecules of the viral Gag protein, which assemble to form the known hexagonal protein lattice in the virus particle. How the Gag proteins pack together in the lattice is incompletely understood. A short segment of Gag known to be critical for proper assembly has been hypothesized to form a six-helix bundle, which may be the nucleating event that leads to lattice formation. The experiments reported here, using the avian Rous sarcoma virus as a model system, further define the nature of this segment of Gag, show that it is in a higher order structure in the virus particle, and provide the first direct evidence that it forms a six-helix bundle in retrovirus assembly. Such knowledge may provide underpinnings for the development of anti-retroviral drugs that interfere with virus assembly.

  • Host miRNA regulation of human cytomegalovirus immediate early protein translation promotes viral latency [PublishAheadOfPrint]

  • Reactivation of human cytomegalovirus (HCMV) is a significant cause of disease and death in immunocompromised patients underscoring the need to understand how latency is controlled. Here we demonstrate that HCMV has evolved to utilize cellular miRNAs in cells that promote latency to regulate expression of a viral protein critical for viral reactivation. Our data reveal that hsa-miR-200 miRNA family members target the UL122 (IE2) 3'UTR, resulting in repression of this viral protein. Utilizing recombinant viruses that mutate the miRNA-binding site results in lytic rather than latent infections compared to wild type virus in ex vivo infections of primary CD34+ cells. Cells permissive for lytic replication demonstrate low levels of these miRNAs. We propose that cellular miRNA regulation of HCMV is critical for maintenance of viral latency.

    Importance Human cytomegalovirus (HCMV) is a herpesvirus that infects a majority of the population. Once acquired, individuals will harbor the virus for life, where the virus remains, for the most part, in a quiet or latent state. Under weakened immune conditions, the virus can reactivate, which can cause severe disease and often death. We have found that a family of small RNAs, termed microRNAs, encoded by human myeloid progenitor cells are capable of repressing a key viral protein, thus enabling the virus to ensure a quiet/latent state. As these progenitor cells mature further down the myeloid lineage towards cells that support active viral replication, the levels of these microRNAs decrease. Together, our data suggest that host cell microRNA regulation of HCMV is important for the quiet/latent state of this pathogen.

  • Comparison of VZV RNA sequences in human neurons and fibroblasts [PublishAheadOfPrint]

  • Varicella zoster virus (VZV) infection causes varicella, after which virus becomes latent in ganglionic neurons. In tissue culture, VZV-infected human neurons remain viable at two weeks, whereas fibroblasts develop cytopathology. Next-generation RNA sequencing was used to compare VZV transcriptomes in neurons and fibroblasts and identified only 12 differentially transcribed genes of the 70 annotated VZV ORFs, suggesting that defective virus transcription does not account for the lack of cell death in VZV-infected neurons in vitro.

  • Differential induction of apoptosis, IFN signaling and phagocytosis in macrophages infected with a panel of attenuated and non-attenuated poxviruses [PublishAheadOfPrint]

  • Due to the essential role macrophages play in antiviral immunity, it is important to understand the intracellular and molecular processes that occur in macrophages following infection with various strains of vaccinia virus, particularly those used as vaccine vectors. Similarities as well as differences were found in macrophages infected with different poxvirus strains, particularly at the level of viral-induced apoptosis and the expression of immunomodulatory genes, as determined by microarray analyses. Interestingly, the attenuated vaccinia strain MVA was particularly efficient in triggering apoptosis, IFN-bbeta; secretion and inducing changes in the expression of genes associated with increased activation of innate immunity, setting it apart from the other five vaccinia strains tested. Taken together, these results increase our understanding of how these viruses interact with human macrophages, at the cellular and molecular level, and suggest mechanisms that may underlay their utility as recombinant vaccine vectors.

    IMPORTANCE Our studies clearly demonstrate that there are substantial biological differences in the patterns of cellular gene expression between macrophages infected with different poxvirus strains and that these changes are due specifically to infection with the distinct viruses. For example, a clear induction in IFNbbeta; mRNA was observed after infection with MVA, but not with other poxviruses. Importantly, antiviral bioassays confirmed that MVA-infected macrophages secreted high level of biologically active type I IFN. Similarly, the phagocytic capacity of macrophages was also specifically increased after infection with MVA. Although the main scope of this study was not to test the vaccine potential of MVA as there are several groups in the field working extensively on this aspect, the characteristics/phenotypes we observed at the in vitro level clearly highlight the inherent advantages that MVA possess in comparison to other poxvirus strains.

  • Cell and Virus Mediated Regulation of the Barrier-to-Autointegration Factor's Phosphorylation State Controls its DNA Binding, Dimerization, Subcellular Localization, and Antipoxviral Activity [PublishAheadOfPrint]

  • Barrier-to-Autointegration Factor (BAF) is a DNA binding protein with multiple cellular functions including the ability to act as a potent defense against vaccinia virus infection. This antiviral function involves BAFrrsquo;s ability to condense double-stranded DNA and subsequently prevent viral DNA replication. In recent years, it has become increasingly evident that dynamic phosphorylation involving the vaccinia B1 kinase and cellular enzymes is likely a key regulator of multiple BAF functions; however the precise mechanisms are poorly understood. Here we analyze how phosphorylation impacts BAFrrsquo;s DNA-binding, subcellular localization, dimerization, and antipoxviral activity through the characterization of BAF phosphomimetic and unphosphorylatable mutants. Our studies demonstrate that increased phosphorylation enhances BAFrrsquo;s mobilization from the nucleus to the cytosol, while dephosphorylation restricts BAF to the nucleus. Phosphorylation also impairs both BAFrrsquo;s dimerization and DNA-binding activity. Furthermore, our studies of BAFrrsquo;s antiviral activity revealed that hyperphosphorylated BAF is unable to suppress viral DNA replication or virus production. Interestingly, the unphosphorylatable BAF mutant, which is capable of binding DNA but localizes predominantly to the nucleus, was also incapable of suppressing viral replication. Thus both DNA-binding and localization are important determinants of BAFrrsquo;s antiviral function. Finally, our examination of how phosphatases are involved in regulating BAF revealed that PP2A dephosphorylates BAF during vaccinia infection, thus counterbalancing the activity of the B1 kinase. Altogether, these data demonstrate that phosphoregulation of BAF by viral and cellular enzymes modulates this protein at multiple molecular levels, thus determining its effectiveness as an antiviral factor and likely other functions as well.

    IMPORTANCE The Barrier to Autointegration Factor (BAF) contributes to cellular genomic integrity in multiple ways, the best-characterized of which are as a host defense against cytoplasmic DNA and as a regulator of mitotic nuclear reassembly. Although dynamic phosphorylation involving both viral and cellular enzymes is likely a key regulator of multiple BAF functions; the precise mechanisms involved are poorly understood. Here we demonstrate that phosphorylation coordinately regulates BAFrrsquo;s DNA-binding, subcellular localization, dimerization, and antipoxviral activity. Overall, our findings provide new insights into how phosphoregulation of BAF modulates this protein at multiple levels and governs its effectiveness as an antiviral factor against foreign DNA.

  • Inhibition of dengue virus replication by a class of small molecule compounds that antagonize dopamine receptor 4 and downstream mitogen activated protein kinase signaling [PublishAheadOfPrint]

  • Dengue viruses (DENV) are endemic pathogens of tropical and subtropical regions and cause significant morbidity and mortality worldwide. Currently, there are no vaccines or antiviral therapeutics approved for combating DENV-associated disease. In this paper, we describe a class of tricylic small molecule compoundsmmdash;dihydrobenzothiepenes (DHBTs), identified through high throughput screeningmmdash;with potent inhibitory activity against DENV serotype 2. SKI-417616, a highly active representative of this class, displayed activity against all four serotypes of DENV, as well as to a related flavivirus, West Nile virus (WNV), and an alphavirus, Sindbis virus (SINV). This compound was characterized to determine its mechanism of antiviral activity. Investigation of the stage of the viral life cycle being affected revealed that an early event in the life cycle is inhibited. Due to similarity in structure of the DHBTs to known antagonists of the dopamine and serotonin receptors, we explored the role of two of these receptors, serotonin receptor 2A (5HTR2A) and the D4 dopamine receptor (DRD4), in DENV infection. Antagonism of DRD4 and subsequent downstream phosphorylation of EGFR-related kinase (ERK) was found to negatively impact DENV infection, and blockade of signaling through this network was confirmed as the mechanism of anti-DENV activity for this class of compounds.

    IMPORTANCE The dengue viruses are mosquito-borne, re-emerging human pathogens that are the etiological agents of a spectrum of febrile diseases. Currently, there are no approved therapeutic treatments for dengue-associated disease, nor is there a vaccine. This study identifies a small molecule, SKI-417616, with potent anti-dengue activity. Further analysis revealed that SKI-417616 acts through antagonism of the host-cell dopamine D4 receptor and subsequent repression of the ERK phosphorylation pathway. These results suggest that SKI-417616, or other compounds targeting the same cellular pathways, may have therapeutic potential for the treatment of dengue virus infections.

  • Nuclear-cytoplasmic partitioning of the Cucumber mosaic virus 2b protein determines the balance between its roles as a virulence determinant and RNA silencing suppressor [PublishAheadOfPrint]

  • The Cucumber mosaic virus (CMV) 2b protein is an RNA silencing suppressor that plays roles in CMV accumulation and virulence. The 2b proteins of subgroup IA CMV strains partition between the nucleus and cytoplasm but the biological significance of this is uncertain. We fused an additional nuclear localization signal (NLS) to the 2b protein of subgroup IA strain Fny-CMV to create 2b-NLS and tested its effects on subcellular distribution, silencing and virulence. The additional NLS enhanced 2b protein nuclear and nucleolar accumulation but nuclear and nucleolar enrichment correlated with markedly diminished silencing suppressor activity in patch assays, and abolished 2b protein-mediated disruption of microRNA activity in transgenic Arabidopsis. Nuclear/nucleolar-localized 2b protein possesses at least some ability to inhibit antiviral silencing but this was not sufficient to prevent recovery from disease in younger, developing leaves in Arabidopsis. However, enhanced nuclear and nucleolar accumulation of 2b increased virulence and accelerated symptom appearance in older leaves. Experiments with Arabidopsis lines carrying mutant Dicer-like alleles demonstrated that compromised suppressor activity explained the diminished ability of 2b-NLS to enhance virus accumulation. Remarkably, the increased virulence 2b-NLS engendered was unrelated to effects on microRNA- or short-interfering RNA-regulated host functions. Thus, although nuclear and nucleolar-localized 2b protein is less efficient at silencing suppression than cytoplasm-localized 2b, it enhances CMV virulence. We propose that partitioning of the 2b protein between the cytoplasmic and nuclear/nucleolar compartments allows CMV to regulate the balance between virus accumulation and damage to the host, presumably to maximize the benefit for the virus.

    IMPORTANCE In this work, the main finding is that nuclear/nucleolar-localized 2b protein is strongly associated with CMV virulence, which is independent of its effect on small RNA pathways. Moreover, this work supports the contention that the silencing suppressor activity of CMV 2b protein is predominantly exerted by that portion of the 2b protein residing in the cytoplasm. Thus, we propose that partitioning of the 2b protein between the cytoplasmic and nuclear/nucleolar compartments allows CMV to regulate the balance between virus accumulation and damage to the host, presumably to maximize the benefit for the virus.

  • The Herpes Simplex Virus Type-1 UL37 Protein Interacts with Viral Glycoprotein gK and Membrane Protein UL20 and Functions in Cytoplasmic Virion Envelopment [PublishAheadOfPrint]

  • We have shown that glycoprotein K (gK) and its interacting partner UL20 protein play crucial roles in virion envelopment. Specifically, virions lacking either gK or UL20 fail to acquire an envelope, thus causing accumulation of capsids in the cytoplasm of infected cells. The HSV-1 UL37 protein has also been implicated in cytoplasmic virion envelopment. To further investigate the role of UL37 in virion envelopment, the recombinant virus DC480 was constructed by insertion of a 12-amino acid protein C epitope tag within the UL37 amino acid sequence immediately after amino acid 480. The DC480 mutant virus expressed full-size UL37 detected by the anti-ProtC antibody in western immunoblots, accumulated unenveloped capsids in the cytoplasm of infected cells, and produced very small plaques on African green monkey kidney (Vero) cells similar in size to those produced by the UL20-null and UL37-null viruses. The DC480 virus replicated nearly four logs less efficiently than the parental wild-type virus when grown on Vero cells. However, DC480 mutant virus titers increased nearly 20-fold when grown on FRT cells engineered to express the UL20 gene in comparison to Vero cells, while the UL37-null virus replicated approximately 20-fold less efficiently than the DC480 virus on FRT cells. Co-immunoprecipitation experiments and proximity ligation assays showed that gK and UL20 interact with the UL37 protein in infected cells. Collectively, these results indicate that UL37 interacts with the gK/UL20 protein complex to facilitate cytoplasmic virion envelopment.

    Importance Herpes simplex viruses acquire thei final envelopes by budding into cytoplasmic membranes derived from the Trans-Golgi network (TGN). Tegument proteins UL36 and UL37 are known to be transported to the TGN sites of virus envelopment and function in virion envelopment, since mutants lacking UL37 accumulate capsids in the cytoplasm that are unable to bud into TGN membranes. Viral glycoprotein K (gK) also functions in cytoplasmic envelopment as a protein complex with the membrane associated protein UL20 (UL20mp). This work shows for the first time that the UL37 protein functionally interacts with glycoprotein K (gK) and UL20 to facilitate cytoplasmic virion envelopment. The work may lead to the design of specific drugs that can interrupt UL37 interactions with the gK/UL20 protein complex providing new ways to combat herpesviral infections.

  • Crystal structure of the herpesvirus inner tegument protein UL37 supports its essential role in control of viral trafficking. [PublishAheadOfPrint]

  • In cells infected with herpesviruses, two capsid-associated, or inner-tegument, proteins UL37 and UL36 control cytosolic trafficking of capsids by as yet poorly understood mechanisms. Here, we report the crystal structure of the N-terminal half of UL37 from pseudorabies virus, an alphaherpesvirus closely related to herpes simplex viruses and varicella-zoster virus. The structure mmdash; the first for any alphaherpesvirus inner tegument protein mmdash; reveals an elongated molecule of a complex architecture, rich in helical bundles. To explore the function of UL37 N terminus, we used the three-dimensional framework provided by the structure in combination with evolutionary trace analysis to pinpoint several surface-exposed regions of potential functional importance and test their importance using mutagenesis. This approach identified a novel functional region important for cell-cell spread. These results suggest a novel role for UL37 in intracellular trafficking that promotes spread of viral infection, which expands the repertoire of UL37 functions in intracellular virus trafficking. Supporting this, the N terminus of UL37 shares a structural similarity with cellular multi-subunit tethering complexes (MTCs), which control vesicular trafficking in eukaryotic cells by tethering transport vesicles to their destination membranes. Our results suggest that UL37 could be the first viral MTC mimic and provide structural rationale for the importance of UL37 for viral trafficking. We propose that herpesviruses may have co-opted MTC functionality of UL37 to bring capsids to cytoplasmic budding destinations and further on to cell junctions for spread to nearby cells.

    IMPORTANCE To move within an infected cell, viruses encode proteins that interact with host trafficking machinery. In cells infected with herpesviruses, two capsid-associated proteins control cytosolic movement of capsids by as yet poorly understood mechanisms. Here, we report the crystal structure for the N-terminal half of one of these proteins, UL37. Structure-based mutagenesis revealed a novel function for UL37 in virion trafficking to cell junctions for cell-cell spread. Unexpected structural similarity to components of cellular multi-subunit tethering complexes, which control vesicular traffic, suggests that UL37 could be the first viral MTC mimic and provides structural basis for the importance of UL37 for viral trafficking.

  • The chicken adenovirus Gam1 protein, an inhibitor of the sumoylation pathway, partially complements ICP0 null mutant HSV-1. [PublishAheadOfPrint]

  • HSV-1 regulatory protein ICP0 stimulates efficient infection via its E3 ubiquitin ligase activity that causes degradation of several cellular proteins, some of which are sumoylated. Chicken adenovirus Gam1 protein also interferes with the sumoylation pathway, and both proteins disrupt PML NBs. We report that Gam1 increases the infection efficiency of ICP0-null mutant HSV-1 by approximately 100-fold, thus strengthening the hypothesis that PML-NB and sumoylation-related mechanisms are important factors in the control of HSV-1 infection.

  • Implication of the bacterial endosymbiont Rickettsia spp. in the whitefly Bemisia tabaci interactions with Tomato yellow leaf curl virus [PublishAheadOfPrint]

  • Numerous animal and plant viruses are transmitted by arthropod vectors in a persistent, circulative manner. Tomato yellow leaf curl virus (TYLCV) is transmitted by the sweet potato whitefly Bemisia tabaci. Here we report that infection with Rickettsia spp., a facultative endosymbiont of whiteflies, altered TYLCV- B. tabaci interactions. A B. tabaci strain infected with Rickettsia acquired more TYLCV from infected plants, retained the virus longer and exhibited nearly double the transmission efficiency than a non-infected strain, with the same genetic background. Temporal and spatial antagonistic relationships were discovered between Rickettsia and TYLCV within the whitefly. Along different time course experiments, the levels of virus and Rickettsia within the insect were inversely correlated. Fluorescence in situ hybridization analysis on Rickettsia-infected midguts showed evidence for niche exclusion between Rickettsia and TYLCV. In particular, high levels of the bacterium in the midgut resulted in higher virus concentration in the filter chamber, a favored site for virus translocation along the transmission pathway, while low levels of Rickettsia in the midgut resulted in an even distribution of the virus. Taken together, these results indicate that Rickettsia, by infecting the midgut, increases TYLCV transmission efficacy, adding further insights into the complex association between persistent plant viruses, their insect vectors and microorganisms tenants that reside within these insects.

    Importance Bacterial endosymbionts in arthropods are gaining great interest in influencing many aspects of their host biology in agricultural and human health systems. A recent and relevant studied example is the influence of Wolbachia on dengue virus transmission by mosquitoes. In parallel with our current studied whitefly-Rickettsia-TYLCV system, studies have now shown that dengue levels in the mosquito vector are inversely correlated with bacterial load. Our work presents evidence of unifying principles between vectors of plant and animal viruses in a role for endosymbionts in manipulating vector biology and pathogen transmission. Our results demonstrate the influence of an interesting and prominent bacterial endosymbiont in Bemisia tabaci in TYLCV transmission, a worldwide disease infecting tomatoes. Besides its agricultural importance, this system provides interesting insights into Bemisia interaction with these newly discovered endosymbionts.

  • Virulence associated genome mutations of murine rotavirus identified by serial passage alternating in mice and cell cultures [PublishAheadOfPrint]

  • Although significant clinical efficacy and safety of rotavirus vaccines were recently revealed in many countries, the mechanism of their attenuation is not well understood. We passaged serially a cell culture-adapted murine rotavirus EB strain in mouse pups or in cell cultures alternately and repeatedly, and fully sequenced all 11 genes of 21 virus samples passaged in mice or in cell cultures. Sequence analysis revealed that mouse-passaged viruses that regained virulence almost consistently acquired 4 kinds of amino acid (aa) substitutions in VP4 and substitution in aa 37 (Val to Ala) in NSP4. In addition, they gained and invariably conserved the 3rrsquo; consensus sequence in NSP1. The molecular changes occurred along with the acquisition of virulence during passages in mice, and then disappeared following passages in cell cultures. Intraperitoneal injection of recombinant NSP4 proteins confirmed the aa site 37 as important for its diarrheogenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence.

    Importance Serial passage of a virulent wild-type virus in vitro often results in loss of virulence of the virus in an original animal host, while serial passage of a cell culture-adapted avirulent virus in vivo often gains virulence in it. Actually, live attenuated virus vaccines were originally produced by serial passage in cell cultures. Although clinical efficacy and safety of rotavirus vaccines were recently revealed, the mechanism of their attenuation is not well understood. We passaged serially a murine rotavirus by alternating switch of host (mice or cell cultures) repeatedly, and sequenced the 11 genes of the passaged viruses to identify mutations associated with emergence or disappearance of virulence. Sequence analysis revealed that changes in 3 genes (VP4, NSP1 and NSP4) were associated with virulence in mice. Intraperitoneal injection of recombinant NSP4 proteins confirmed its diarrheogenic activity in mice. These genome changes are likely to be correlated with rotavirus virulence.

  • Cytosolic DNA-Mediated, STING-Dependent Pro-Inflammatory Gene Induction Necessitates canonical NF-{kappa}B activation Through TBK1. [PublishAheadOfPrint]

  • STING (stimulator of interferon genes) is known to control the induction of innate immune genes in response to the recognition of cytosolic DNA species, including the genomes of viruses such as HSV1. However, while STING is essential for protection of the host against numerous DNA pathogens, sustained STING activity can lead to lethal inflammatory disease. It is known that STING utilizes interferon regulatory 3 (IRF3) and nuclear factor B (NF-B) pathways to exert its effects, although the signal transduction mechanisms remain to be fully clarified. Here, we demonstrate that in addition to the activation of these pathways, potent induction of the JNK/SAPK pathway was similarly observed in response to STING activation by dsDNA. Further, TANK-binding kinase 1 (TBK1) associated with STING, was found to facilitate dsDNA-mediated canonical activation of NF-B as well as IRF3 to promote pro-inflammatory gene transcription. The triggering of NF-B function was noted to require TRAF6 activation. Our findings detail a novel dsDNA-mediated NF-B activation pathway facilitated through a STING/TRAF6/TBK1 axis and suggest a target for therapeutic intervention to plausibly stimulate anti-viral activity or alternatively avert dsDNA-mediated inflammatory disease.

    IMPORTANCE The IKK complex, which is composed of two catalytic subunits, IKKaalpha; and IKKbbeta; has been suggested to be essential for the activation of canonical NF-B signaling in response to various stimuli including cytokines (e.g. IL-1aalpha;, TNF-aalpha;), TLR ligands (e.g. LPS), and dsRNA derived from viruses or a synthetic analog. STING has been identified as a critical signaling molecule required for the detection of cytosolic dsDNA derived from pathogens and viruses. However little is known about how cytosolic dsDNA triggers NF-B signaling. In the present study, we demonstrate that TBK1, identified as an IKK-related kinase, may predominantly control the activation of NF-B in response to dsDNA signaling via STING through the IKKaalpha;bbeta; activation loop. Thus, our results establish TBK1 as a downstream kinase controlling dsDNA-mediated IRF3 and NF-B signaling dependent on STING.

  • Highly specific salt bridges govern bacteriophage P22 icosahedral capsid assembly: identification of the site in coat protein responsible for interaction with scaffolding protein [PublishAheadOfPrint]

  • Icosahedral virus assembly requires a series of concerted reactions of highly specific protein-protein interactions to produce a proper capsid. In bacteriophage P22, only coat protein (gp5) and scaffolding protein (gp8) are needed to assemble a procapsid-like particle, both in vivo and in vitro. In scaffolding proteinrrsquo;s coat binding domain, residue R293 is required for procapsid assembly, while residue K296 is important but not essential. Here we investigate the interaction of scaffolding protein with acidic residues in the N-arm of coat protein, since interaction has been shown to be electrostatic. Through site-directed mutagenesis of genes 5 and 8 we show that changing the coat protein N-arm residue 14 from aspartic acid to alanine causes a lethal phenotype. Coat protein D14 is shown by crosslinking to interact with scaffolding protein residue R293, and thus is intimately involved in proper procapsid assembly. To a lesser extent, the coat protein N-arm residue E18 is also implicated in interaction with scaffolding protein and is involved in capsid size determination, since a cysteine mutation at this site generated petite capsids. The final acidic residue in the N-arm that was tested, E15, is shown to only weakly interact with scaffolding proteinrrsquo;s coat binding domain. This work supports growing evidence that surface charge density may be the driving force of virus capsid protein interactions.

    Importance Bacteriophage P22 infects Salmonella enterica serovar Typhimurium and is a model for icosahedral viral capsid assembly. In this system, coat protein interacts with an internal scaffolding protein, which triggers assembly of an intermediate called a procapsid. Previously, we determined there is a single amino acid in scaffolding protein required for P22 procapsid assembly, though others modulate affinity. Here, we identify partners in coat protein. We show experimentally that relatively weak interactions between coat and scaffolding proteins are capable of driving correctly shaped and sized procapsids, and that the lack of these proper protein:protein interfaces leads to aberrant structures. The present work represents an important contribution to the growing knowledge that virus capsid assembly is governed by seemingly simple interactions. The highly specific nature of the subunit interfaces suggests that these could be good targets for anti-virals.

  • YEAST VIRUS-DERIVED STIMULATOR OF THE INNATE IMMUNE SYSTEM AUGMENTS THE EFFICACY OF A VIRAL-VECTOR BASED IMMUNOTHERAPEUTIC [PublishAheadOfPrint]

  • To identify novel stimulators of the innate immune system, we constructed a panel of eight HEK293-cells lines, double-positive for human Toll-like receptors (TLR) and a NF-B-inducible reporter gene. Screening a large variety of compounds and cellular extracts detected a TLR3 activating compound in a microsomal yeast extract. Fractionation of this extract identified a RNA molecule of 4.6 kb, named Nucleic Acid Band 2 (NAB2) that was sufficient to confer the activation of TLR3. Digests with single- and double-strand-specific RNases showed the double-strand nature of this RNA, and its sequence was found to be identical to the genome of the dsRNA L-BC virus of Saccharomyces cerevisiae. A large scale production and purification process of this RNA was established based on chemical cell lysis and dsRNA-specific chromatography. NAB2 complexed with the cationic lipid Lipofectin, but neither NAB2 nor Lipofectin alone, induced the secretion of IL-12(p70), IFNaalpha;, IP-10, Mip-1bbeta; and IL-6 in human monocyte-derived dendritic cells. While NAB2 activated TLR3, Lipofectin-stabilized NAB2 signaled also via the cytoplasmic sensor for RNA recognition MDA-5. Significant increase of RMA-MUC1 tumor rejection and survival was observed in C57BL/6 mice after prophylactic vaccination with MUC1-encoding MVA and NAB2+Lipofectin. This combination of immunotherapeutics strongly increased the percentage of infiltrating Natural Killer (NK) cells and plasmacytoid dendritic cells (pDCs) at the injection sites, cell types which can modulate innate and adaptive immune responses.

    IMPORTANCE Virus-based cancer vaccines offer a good therapeutic alternative to cancer but could be improved. Starting from a screening approach, we have identified and characterized an unexplored biological molecule with immune-modulatory characteristics which augments the efficacy of a MVA-based immunotherapeutic. The immune modulator consists of the purified dsRNA genome isolated from commercially used yeast strain, NAB2, mixed with a cationic lipid, Lipofectin. NAB2+Lipofectin stimulate the immune system via TLR3 and MDA-5. Injected at the MVA-vaccination site, the immune-modulator increased survival in a preclinical tumor-model. We could demonstrate that NAB2+Lipofectin augments the MVA-induced infiltration of Natural Killer and plasmacytoid dendritic cells. We suggest indirect mechanisms of activation of these cell types by NAB2+Lipofectin influencing innate and adaptive immunity. Detailed analysis of cell migration at the vaccine injection site and the appropriate choice of the immune modulator should be considered towards a rationale improvement of virus-vector-based vaccination by immune-modulators.

  • Functional analysis of nuclear localisation signals in VP1-2 homologues from all herpesvirus subfamilies [PublishAheadOfPrint]

  • The herpes simplex virus (HSV) tegument protein VP1-2 contains an N-terminal nuclear localisation signal (NLS) that is critical for capsid routing to the nuclear pore. Here we analyse positionally conserved determinants in VP1-2 homologues from each of the aalpha;, bbeta; and classes of human herpesviruses. The overall architecture of the VP1-2s was similar with a conserved N-terminal ubiquitin specific protease domain separated from an internal region by a linker that was quite poorly conserved in length and sequence. Within this linker region all herpesviruses contained a conserved, highly basic motif which nevertheless exhibited distinct class-specific features. The motif in HSV functioned as a monopartite NLS while in VZV activity required an adjacent basic section defining the motif as a bipartite NLS. Neither the bbeta;- nor -herpesvirus VP1-2 motifs were identified by prediction algorithms but nevertheless functioned as efficient NLS motifs in both heterologous transfer assays and in HSV VP1-2. Furthermore though with different efficiencies, and with the exception of HHV-8, these chimeric variants rescued the replication defect of a HSV mutant lacking its NLS motif. We demonstrate that the lysine at position 428 of HSV is critical for replication with a single substitution to alanine sufficient to abrogate NLS function and virus growth. We conclude that the basic motifs of each of the VP1-2 proteins is likely to confer a similar function in capsid entry in the homologous setting and while there is flexibility in the exact type of motif employed, specific individual residues are critical for function.

    IMPORTANCE To successfully infect cells all herpesviruses, along with many viruses e.g., HIV, hepatitis B virus and influenza, must navigate through the cytoplasmic environment and dock with nuclear pores for transport of their genomes into the nucleus. However we still have a limited understanding of the detailed mechanisms involved. Insight into these events are needed and could offer opportunities for therapeutic intervention. This work investigates the role of a specific determinant in the structural protein VP1-2 in herpesvirus entry. We examine this determinant in representative VP1-2s from all herpesvirus subfamilies, demonstrate NLS function, dissect key residues and show functional relevance in rescuing replication of the mutant blocked in capsid navigation to the pore. The results are important and strongly support our conclusions of the generality that these motifs are crucial for entry of all herpesviruses. They also facilitate future analysis on selective host interactions and possible routes to disrupt function.

  • NELFINAVIR INHIBITS MATURATION AND EXPORT OF HERPES SIMPLEX VIRUS TYPE 1 [PublishAheadOfPrint]

  • Nelfinavir (NFV) is an HIV-1 protease inhibitor with demonstrated antiviral activity against herpes simplex virus type 1 (HSV-1) and several other herpesviruses. However, the stages of HSV-1 replication inhibited by NFV have not been explored. In this study, we investigated the effects of NFV on capsid assembly and envelopment. We confirmed the inhibitory effects of NFV on HSV-1 replication by plaque assay and found that treatment with NFV did not affect capsid assembly, activity of the HSV-1 maturational protease, or formation of DNA-containing capsids in the nucleus. Confocal and electron microscopy showed that these capsids were transported to the cytoplasm but failed to complete secondary envelopment and subsequent exit from the cell. Consistent with microscopy results, a light-scattering band corresponding to enveloped virions was not evident following sucrose gradient rate-velocity separation of lysates from drug-treated cells. Evidence of a possibly related effect of NFV on viral glycoprotein maturation was also discovered. NFV also inhibited the replication of an HSV-1 thymidine kinase mutant resistant to nucleoside analogues such as acyclovir. Given that NFV is neither a nucleoside mimic nor a known inhibitor of nucleic acid synthesis, this was expected and suggests its potential as a co-inhibitor or alternate antiviral therapeutic agent in cases of resistance.

    IMPORTANCE Nelfinavir (NFV) is a clinically important antiviral drug that inhibits production of infectious human immunodeficiency virus (HIV). It was reported to inhibit herpesviruses in cell culture. Herpes simplex type 1 (HSV-1) infections are common and often associated with several diseases. The studies we describe here confirm and extend the findings by investigating how NFV interferes with HSV-1 replication. We show that early steps in virus formation appear unaffected by NFV (e.g., assembly of DNA-containing capsids in the nucleus and their movement into the cytoplasm), whereas later steps are severely restricted by the drug (e.g., final envelopment in the cytoplasm and release of infectious virus from the cell). Our findings provide the first insight into how NFV inhibits HSV-1 replication and suggest this drug may have applications in studying the herpesvirus envelopment process. Additionally, NFV may have therapeutic value alone or in combination with other antivirals in treating herpesvirus infections.

  • Human Herpesvirus 6A infection in CD46 transgenic mice: viral persistence in the brain and increased production of proinflammatory chemokines via TLR9 [PublishAheadOfPrint]

  • Human herpesvirus 6 (HHV-6) is widely spread in the human population and has been associated with several neuroinflammatory diseases, including multiple sclerosis. To develop a small animal model of HHV-6 infection, we analyzed the susceptibility of several lines of transgenic mice, expressing human CD46, identified as a receptor for HHV-6. We showed that HHV-6A (GS) infection results in the expression of viral transcripts in primary brain glial cultures from CD46-expressing mice, while HHV-6B (Z29) infection was inefficient. HHV-6A DNA persisted for up to 9 months in the brain of CD46-expressing mice but not in the non-transgenic littermates, whereas HHV-6B DNA levels decreased rapidly after infection in all mice. Persistence in the brain was observed only with infectious but not heat-inactivated HHV-6A. Immunohistological studies revealed the presence of infiltrating lymphocytes and monocytes in periventricular areas of the brain of HHV-6A-infected mice. Furthermore, HHV-6A stimulated the production of panel of proinflammatory chemokines in primary brain glial cultures, including CCL2, CCL5 and CXCL10 and induced the expression of CCL5 in the brains of HHV-6A-infected mice. HHV-6A-induced production of chemokines in the primary glial cultures was dependent on the stimulation of toll-like receptor 9 (TLR9). Finally, HHV-6A induced signaling through human TLR9 as well, extending thus observations from the murine model to human infection. Altogether, this study presents a first murine model for HHV-6A-induced brain infection and suggests a role for TLR9 in the HHV-6A- initiated production of proinflammatory chemokines in the brain, thus opening novel perspectives for the study of virus-associated neuropathology.

    Importance section Human herpesvirus 6 (HHV-6) infection has been related to neuroinflammatory diseases, however, the lack of suitable small animal infection model has considerably hampered further studies of HHV-6-induced neuropathogenesis. In this study, we have characterized a new model for HHV-6 infection in mice expressing the human CD46 protein. Infection of CD46 transgenic mice with HHV-6A resulted in a long-term persistence of viral DNA in the brains of infected animals and was followed by lymphocyte infiltration and upregulation of the CCL5 chemokine, in the absence of clinical signs of disease. The secretion of a panel of chemokines was increased after infection in primary murine brain glial cultures and the HHV-6-induced chemokine expression was inhibited when TLR9 signaling was blocked. These results describe the first murine model for HHV-6A-induced brain infection and suggest the importance of TLR9 pathway in the HHV-6A-initiated neuroinflammation.

  • Role of poultry in spread of novel H7N9 influenza virus in China [PublishAheadOfPrint]

  • The recent outbreak of H7N9 influenza in China has resulted in many human cases with a high fatality rate. Poultry are the likely source of infection for humans based on sequence analysis and virus isolations from live bird markets, but itrrsquo;s not clear which species of birds are most likely to be infected and shedding sufficient levels of virus to infect humans. Intranasal inoculation of chickens, Japanese quail, pigeons, Pekin ducks, Mallard ducks, Muscovy ducks, and Embden geese with 106 EID50 of the A/Anhui/1/2013 virus resulted in infection but no clinical disease signs. Virus shedding in quail and chickens was much higher and prolonged than in the other species. Quail effectively transmitted the virus to direct contacts but pigeons and Pekin ducks did not. In all species, virus was detected at much higher titers from oropharyngeal swabs than cloacal swabs. The HA gene from samples collected from selected experimentally infected birds were sequenced and three amino acid differences were commonly observed when compared to A/Anhui/1/2013: N123D, N149D, and L217Q. Leucine at position 217 is highly conserved for avian isolates and is associated with aalpha;;2,6 sialic acid binding. Different amino acid combinations were observed suggesting that the inoculum had viral subpopulations that were selected after passage in birds. These experimental studies corroborate that certain poultry species are reservoirs of the H7N9 influenza virus, and that the virus is highly upper respiratorytropic so testing of bird species should preferentially be conducted with oropharyngeal swabs for best sensitivity.

    IMPORTANCE The recent outbreak of H7N9 in China has resulted in a number of human infections with a high case fatality rate. The source of the viral outbreak is suspected to be from poultry, but definitive data for the source of the infection is not known. This study provides experimental data to show that quail and chickens are susceptible to infection and shed large amounts of virus and are likely important in the spread of the virus to humans. Other poultry species, including Muscovy ducks, can be infected and shed virus, but are less likely to play a role of transmitting the virus to humans. Pigeons were previously suggested as a possible source of virus because of isolation of virus from several pigeons in poultry markets in China, but experimental studies show they are generally resistant to infection and are unlikely to play a role in spread of the virus.

  • Complementary induction of immunogenic cell death by oncolytic parvovirus H-1PV and gemcitabine in pancreatic cancer [PublishAheadOfPrint]

  • The novel therapies employing oncolytic viruses have emerged as promising anticancer modalities. The cure of particularly aggressive malignancies requires an induction of immunogenic cell death (ICD) coupling oncolysis with immune responses via calreticulin, ATP, and high-mobility group box protein B1 (HMGB1) release from dying tumor cells. The present study showed that in human pancreatic cancer cells (PDAC, n=4), oncolytic parvovirus H-1 (H-1PV) activated multiple interconnected death pathways but failed to induce calreticulin exposure or ATP release. In contrast, H-1PV elevated extracellular HMGB1 levels by 4.0pplusmn;0.5 times (58pplusmn;9% of total content; up to 100 ng/ml) in all infected cultures, whether non-dying, necrotic or apoptotic. Alternative secretory route allowed H-1PV to overcome failure of gemcitabine to trigger HMGB1 release, and that without impeding cytotoxicity or other ICD-activities of the standard PDAC medication. Such broad resistance of H-1PV-induced HMGB1 release to apoptotic blockage coincided but was uncoupled from an autocrine IL1b-loop. That and the pattern of the viral determinants maintained in gemcitabine-treated cells suggested an activation of inflammasome/CASP1-platform alongside with DNA detachment and/or nuclear exclusion of HMGB1 during early stages of the viral life cycle. We concluded that H-1PV infection of PDAC cells is signalled through secretion of alarmin HMGB1, and besides its own oncolytic effect, might convert drug-induced apoptosis into an ICD-process. A transient arrest of cells in cyclinA1-rich S-phase would suffice to support compatibility of proliferation-dependent H-1PV with cytotoxic regimens. These properties warrant incorporation of the oncolytic virus H-1PV which is not-pathogenic in humans into multimodal anticancer treatments.

    Importance: The current therapeutic concepts targeting aggressive malignancies require induction of immunogenic cell death characterized by an exposure of CRT as well as release of ATP and HMGB1 from dying cells. In pancreatic tumor cells (PDAC) infected with oncolytic parvovirus H-1PV, only HMGB1 was released by all infected cells, whether non-dying, necrotic or succumbing to one of the programmed death pathways, including contra-productive apoptosis. Our data suggested that HMGB1 active secretion in PDAC is a sentinel reaction emerging during early stages of the viral life cycle irrespective of cell death, compatible with and complementing cytotoxic regimens. Consistent induction of HMGB1 secretion raised the possibility that this reaction might be a general llsquo;alarmingrrsquo; phenomenon characteristic for H-1PV interaction with the host cell; release of IL1b pointed to possible involvement of a danger-sensing inflammasome platform. Both provide a basis for further virus-oriented studies.

  • Crystal structure of Marburg virus VP24 [PublishAheadOfPrint]

  • The VP24 protein plays an essential, albeit poorly understood role in the filovirus life cycle. VP24 is only 30% identical between Marburg virus and the ebolaviruses. Further, VP24 from the ebolaviruses is immunosuppressive, while that of Marburg virus is not. The crystal structure of Marburg virus VP24, presented here, reveals that although the core is similar between the viral genera, Marburg VP24 is distinguished by a projecting beta shelf and an alternate conformation of the N-terminal polypeptide.

  • Anti-lyssaviral activity of interferon {kappa} and {omega} from the Serotine bat, Eptesicus serotinus [PublishAheadOfPrint]

  • Interferons (IFNs) are cytokines produced by host cells in response to the infection with pathogens. By binding to the corresponding receptors, IFNs trigger different pathways to block intracellular replication and growth of pathogens and to impede the infection of surrounding cells. Due to their key role in host defence against viral infections as well as for clinical therapies, the IFN responses and regulation mechanisms are well studied. However, studies on type I IFNs are mainly focusing on IFNaalpha; and bbeta; subtypes. Knowledge about IFN and is limited. Moreover, most of the studies are done in humans or mouse models but not in the original host of zoonotic pathogens.

    Bats are important reservoirs and transmitters of zoonotic viruses like lyssaviruses. A few studies have shown an antiviral activity of IFNs in fruit bats. However, the function of type I IFNs against lyssaviruses in bats is not studied yet. Here, IFN and IFN genes from European serotine bat, Eptesicus serotinus, were cloned and functionally characterized. E. serotinus IFN and IFN genes are intron-less and well conserved between Microchiropterean species. The promoter regions of both genes contain essential regulatory elements for transcription factors. In vitro studies indicated a strong activation of IFN signalling by recombinant IFN, whereas IFN displayed weaker activation. Noticeably, both IFNs inhibit to different extents the replication of different lyssaviruses in susceptible bat cell line. The present study provides functional data on the innate host defence against lyssaviruses in endangered European bats.

    Importance In this manuscript we describe for the first time the molecular and functional characterization of two type I interferons (IFN and ) from European serotine bat (Eptesicus serotinus). The importance of this study is mainly based on the fact that very limited information about the early innate immune response against bat Lyssaviruses in their natural host serotine bats is yet available. Generally, whereas the antiviral activity of other type I interferons is well studied the functional involvement of IFN and is not yet investigated.

  • Upolu virus and Aransas Bay virus, two presumptive bunyaviruses, are novel members of the family Orthomyxoviridae [PublishAheadOfPrint]

  • Emerging and zoonotic pathogens pose continuing threats to human health and ongoing challenges to diagnostics. As nucleic acid tests are playing increasingly prominent roles in diagnostics, the genetic characterization of molecularly uncharacterized agents is expected to significantly enhance detection and surveillance capabilities. We report the identification of two previously unrecognized members of the family Orthomyxoviridae, which includes the influenza viruses and the tick-transmitted Thogoto and Dhori viruses. We provide morphologic, serologic and genetic evidence that Upolu virus (UPOV) from Australia and Aransas Bay virus (ABV) from North America, both previously considered potential bunyaviruses based on electron microscopy and physicochemical features, are orthomyxoviruses instead. Their genomes show up to 68% nucleotide sequence conservation to Thogoto virus (segment 2; ~74% at amino acid level) and a more distant relationship to Dhori virus, the two prototype viruses of the recognized species in the genus Thogotovirus. Despite sequence similarity, the coding potential of UPOV and ABV differed from Thogoto virus, being instead like that of Dhori virus. Our findings suggest that the tick-transmitted UPOV and ABV represent geographically distinct viruses in the genus Thogotovirus of the family Orthomyxoviridae that do not fit in the two currently recognized species of that genus.

    Importance. Upolu virus (UPOV) and Aransas Bay virus (ABV) are shown to be orthomyxoviruses instead of bunyaviruses as previously thought. Genetic characterization and adequate classification of agents is paramount in this molecular age to devise appropriate surveillance and diagnostics. Although closer to Thogoto virus by sequence, UPOV and ABV differ in their coding potential by lacking a proposed pathogenicity factor. In this respect they are similar to Dhori virus, which despite this lack can cause disease. These findings enable further studies into the evolution and pathogenicity of orthomyxoviruses.

  • Defective interfering influenza virus RNAs: time to re-evaluate their clinical potential as broad spectrum antivirals? [PublishAheadOfPrint]

  • Defective interfering (DI) RNAs are highly deleted forms of the infectious genome that are made by most families of RNA viruses. DI RNAs retain replication and packaging signals, are synthesized preferentially over infectious genomes, and are packaged as DI virus particles which can be transmitted to susceptible cells. Their ability to interfere with the replication of infectious virus in cell culture, and their potential as antivirals in the clinic has long been known. However, up to now, no realistic formulation has been described. In this review, we consider the early evidence of antiviral activity by DI viruses and, using the example of DI influenza A virus, and outline developments that have led to the production of a cloned DI RNA that is highly active in preclinical studies not only against different subtypes of influenza A virus but also against heterologous respiratory viruses. These data suggest that it is timely to reassess the potential of DI viruses as a novel class of antivirals that may have general applicability.

  • The brown planthopper nudivirus DNA integrated in its host genome [PublishAheadOfPrint]

  • The brown planthopper (BPH), Nilaparvata lugens (Hemiptera: Delphacidae), is one of the most destructive insect pests of rice crops in Asia. Nudivirus-like sequences were identified during the whole genome sequencing of BPH. PCR examination showed that the virus sequences were present in all of the 22 BPH populations collected from East, Southeast and South Asia. Thirty-two of the 33 nudivirus core genes were identified, including 20 homologues of baculovirus core genes. In addition, several gene clusters that arranged collinearly with other nudiviruses were found in the partial virus genome. In a phylogenetic tree constructed using the supermatrix method, the original virus was grouped with other nudivirus and closely related to polydnavirus. Taken together, these data indicated that the virus sequences belong to a new member of the family Nudiviridae. More specifically, the virus sequences were integrated into the chromosome of its insect host during co-evolution. This study is the first report of a large double-stranded circular DNA virus/genome in a sap-sucking hemipteran insect.

    Importance This is the first report of a large double-stranded DNA virus integrated genome in the planthopper, a plant sap-sucking hemipteran insect. It is an exciting addition to the evolutionary story of Bracoviruses (polydnaviruses), Nudiviruses and Baculoviruses. The result of the virus sequences integrated in the chromosomes of its insect host is also a successful co-evolutionary story of an invertebrate virus and a plant sap-sucking insect.

  • Identification of alternative transcripts encoding the essential murine gammaherpesvirus lytic transactivator RTA [PublishAheadOfPrint]

  • The essential immediate-early transcriptional activator RTA, encoded by gene 50, is conserved among all characterized gammaherpesviruses. Analyses of a recombinant murine gamma-herpesvirus 68 lacking both of the known gene 50 promoters (G50pDblKO) revealed that this mutant retained the ability to replicate in the simian kidney epithelial cell line Vero, but not in permissive murine fibroblasts following low MOI infection. However, G50pDblKo replication in permissive fibroblasts was partially rescued by high MOI infection. In addition, replication of the G50pDblKO virus was rescued by growth on MEFs isolated from IFNaalpha;/bbeta;R-/- mice, while growth on Vero cells was suppressed by the addition of IFNaalpha;. 5rrsquo; rapid amplification of cDNA ends (RACE) analyses of RNA prepared from G50pDblKo and wild-type MHV68 infected murine macrophages identified three novel gene 50 transcripts initiating from 2 transcription initiation sites located upstream of the currently defined proximal and distal gene 50 promoters. In transient promoter assays neither of the newly identified gene 50 promoters exhibited sensitivity to IFNaalpha; treatment, although RTA levels were lower in IFNaalpha;-responsive cells infected with the G50pDblKo mutant. Infection of mice with the MHV68 G50pDblKo virus demonstrated that this mutant virus was able to establish latency in the spleen and peritoneal exudates cells (PECs) of C57Bl/6 mice with about 1/10 the efficiency of wild-type virus or marker rescue virus. However, despite the ability to establish latency, the G50pDblKo virus mutant was severely impaired in its ability to reactivate from either latently infected splenocytes or PECs. Consistent with the ability to rescue replication of the G50pDblKO mutant by growth on type I interferon receptor null MEFs, infection of IFNaalpha;/bbeta;R-/- mice with the G50pDblKo mutant virus demonstrated partial rescue of: (i) acute virus replication in the lungs; (ii) establishment of latency; and (iii) reactivation from latency. The identification of additional gene 50/RTA transcripts highlight the complex mechanisms involved in controlling expression of RTA, likely reflecting time dependent and/or cell-specific roles of different gene 50 promoters in controlling virus replication. Furthermore, the newly identified gene 50 transcripts may also act as negative regulators that modulate RTA expression.

    IMPORTANCE The viral transcription factor RTA, encoded by open reading frame 50 (Orf50), is well conserved among all known gammaherpesviruses and is essential for both virus replication and reactivation from latently infected cells. Previous studies have shown that regulation of gene 50 transcription is complex. The studies reported here describe the presence of additional alternatively initiated, spliced transcripts that encode RTA. Understanding how expression of this essential viral gene product is regulated may identify new strategies for interfering with infection in the setting of gammaherpesvirus-induced diseases.

  • The stability of HSV-1 ICP0 early after infection is defined by the RING finger and the UL13 protein kinase [PublishAheadOfPrint]

  • Herpes simplex virus 1 (HSV-1) infected cell protein No.0 (ICP0) is a multifunctional protein that plays a key role in overcoming numerous facets of host innate immunity. A key function of ICP0 that requires an intact RING finger domain is that of an ubiquitin E3 ligase: ICP0 interacts with at least three ubiquitin conjugating enzymes of which one, UbcH5a is required for degradation of PML and SP100. A preceding report showed that ICP0 is highly unstable at very early times after infection but becomes stable at later times. Here we report that (a) the degradation of ICP0 is not infected cells specific, (b) the degradation does not require the interaction of ICP0 with either UbcH5a, UbcH6 or UbcH9, (c) ICP0 is degraded both early and late in cells infected with a mutant lacking the UL13 protein kinase, (d) ICP0 encoded by wild-type virus or the UL13 mutant are stable in cells transfected with a plasmid encoding UL13 before infection, (e) ICP0 carrying mutations in the RING finger domain is stable both early and late in infection and finally, (f) In cells infected with both wild type and RING finger mutant only the wild-type ICP0 is rapidly degraded at early times. The results suggest that the stability of ICP0 is mediated by the UL13 protein kinase and that the target of proteolysis is a site at or near the RING domain of ICP0.

    Importance ICP0, a major regulatory protein of HSV-1 turns over rapidly early in infection but becomes stable at late times. We report that stabilization requires the presence of UL13 protein kinase and that an ICP0 with mutations in RING finger is stable. In mixed infections mutant ICP0 is stable whereas the wild-type ICP0 is degraded. Our findings suggest that the life-style of HSV-1 requires an ICP0 that turns over rapidly if late proteins are absent.

  • A Critical Determinant of Neurological Disease Associated with Highly Pathogenic Tick-borne Flavivirus in Mice [PublishAheadOfPrint]

  • Tick-borne encephalitis virus (TBEV) and Omsk hemorrhagic fever virus (OHFV) are highly pathogenic tick-borne flaviviruses; TBEV causes neurological disease in humans while OHFV causes a disease typically identified with hemorrhagic fever. Although TBEV and OHFV are closely related genetically, the viral determinants responsible for these distinct disease phenotypes have not been identified. In this study, chimeric viruses incorporating components of TBEV and OHFV were generated using infectious clone technology and their pathological characteristics were analyzed in a mouse model to identify virus-specific determinants of disease. We found that only four amino acids near the C-terminus of the NS5 protein were primarily responsible for the development of neurological disease. Mutation of these four amino acids had no effect on viral replication or histopathological features, including inflammatory responses, in mice. These findings suggest a critical role of NS5 in stimulating neuronal dysfunction and degeneration following TBEV infection and provide new insights into the molecular mechanisms underlying the pathogenesis of tick-borne flaviviruses.

    Importance Tick-borne encephalitis virus (TBEV) and Omsk hemorrhagic fever virus (OHFV) belong to the tick-borne encephalitis serocomplex, genus Flavivirus, family Flaviviridae. Although TBEV causes neurological disease in humans while OHFV causes a disease typically identified with hemorrhagic fever. In this study, we investigated the viral determinants responsible for the different disease phenotypes using reverse genetics technology. We identified a cluster of only four amino acids in non-structural protein 5 primarily involved in the development of neurological disease in a mouse model. Moreover, the effect of these four amino acids was independent of viral replication property, and did not affect the formation of virus-induced lesions in the brain directly. These data suggest that these amino acids may be involved in the induction of neuronal dysfunction and degeneration in virus-infected neurons, ultimately leading to the neurological disease phenotype. These findings provide new insight into the molecular mechanisms of tick-borne flavivirus pathogenesis.

  • PrP expression level and sensitivity to Prion infection [PublishAheadOfPrint]

  • Mice overexpressing the PrP sequence from various host species are widely used for measuring infectious titers in prion disease. However the impact that the transgene expression level might have on the susceptibility to infection raises some concerns about the final biological relevance of these models. Here we report that the endpoint titration of a sheep scrapie isolate in sheep and in mice overexpressing the ovine PrP result in similar estimates of the infectious titer.

  • Local control of repeat dose rectal challenges in DNA/MVA vaccinated macaques protected against a 1st series of SIV challenges [PublishAheadOfPrint]

  • Here we report the results of a late boost and three additional series of simian immunodeficiency virus (SIV) challenges in seven DNA/MVA vaccinated macaques who resisted a first series of rectal challenges. During 29 additional challenges delivered over 2.3 years, all animals became infected. However, 13 blips of virus in six rhesus and anamnestic Env-specific rectal IgA responses in three of the six suggested that local control of infections was occurring during the serial challenge.

  • Genome scale patterns of recombination between co-infecting vaccinia viruses [PublishAheadOfPrint]

  • Recombination plays a critical role in virus evolution. It helps avoid genetic decline and creates novel phenotypes. This promotes survival, and genome sequencing suggests that recombination has facilitated the evolution of human pathogens including Orthopoxviruses like variola virus. Recombination can also be used to map genes, but although recombinant poxviruses are easily produced in culture, classical attempts to map the vaccinia virus (VACV) genome this way, met with little success. We have sequenced recombinants formed when VACV TianTan and Dryvax strains are crossed under different conditions. These were a single round of growth in co-infected cells, five rounds of sequential passage, or using Leporipoxvirus-mediated DNA reactivation. Our studies showed that recombinants contain a patchwork of DNA, with the number of exchanges increasing with passage. Further passage also selected for TianTan DNA and correlated with increased plaque size. The recombinants produced through a single round of co-infection contain a disproportionate number of short conversion tracks (llt;1 kbp) and exhibited 1 exchange per 12 kbp, close to the ~1 per 8 kbp in the literature. One byproduct of this study was that rare mutations were also detected, VACV replication produces ~1x10-8 mutations per nucleotide copied per cycle of replication and ~1 large (21 kbp) deletion per 70 rounds of passage. Viruses produced using DNA reactivation appeared no different from recombinants produced using ordinary methods. An attractive feature of this approach is that, when combined with selection for a particular phenotype, it provides a way of mapping and dissecting more complex virus traits.

    IMPORTANCE When two closely related viruses co-infect the same cell, they can swap genetic information through a process called recombination. Recombination produces new viruses bearing different combinations of genes, and it plays an important role in virus evolution. Poxviruses are a family of viruses that includes variola (or smallpox) virus and although poxviruses are known to recombine, no one has previously mapped the patterns of DNAs exchanged between viruses. We co-infected cells with two different vaccinia poxviruses, isolated the progeny, and sequenced them. We show that poxvirus recombination is a very accurate process that assembles viruses containing DNA copied from both parents. In a single round of infection, DNA is swapped back and forth ~18 times per genome to make recombinant viruses that are a mosaic of the two parental DNAs. This mixes many different genes in complex combinations and illustrates how recombination can produce viruses with greatly altered disease potential.

  • Boosting Functional Avidity of CD8+ T Cells by Vaccinia Virus Vaccination Depends on T-cell Intrinsic MyD88 Expression but not the Inflammatory Milieu [PublishAheadOfPrint]

  • T-cell functional avidity is a crucial determinant for efficient pathogen clearance. Although recombinant DNA priming coupled with a vaccinia vectored vaccine (VACV) boost has been widely used to mount robust CD8+ T cell responses, how VACV boost shapes the properties of memory CD8+ T cells remains poorly defined. Herein, we characterize the memory CD8+ T cells boosted by VACV and demonstrate that the intrinsic expression of MyD88 is critical for their high functional avidity. Independent of selection of clones with high-affinity TCR or of enhanced proximal TCR signaling, the VACV boost significantly increased T-cell functional avidity through a decrease in the activation threshold. VACV-induced inflammatory milieu is not sufficient for this improvement as simultaneous administration of the DNA vaccine and mock VACV had no effects on the functional avidity of memory CD8+ T cells. Furthermore, reciprocal adoptive transfer models revealed that the intrinsic MyD88 pathway is required for instructing the functional avidity of CD8+ T cells boosted by VACV. Taken together, the intrinsic MyD88 pathway is required for the high functional avidity of VACV-boosted CD8+ T cells independent on TCR selection or the VACV infection-induced MyD88-mediated inflammatory milieu.

    Importance paragraph The functional avidity is one of the crucial determinants of T-cell functionality. Interestingly, although it's demonstrated that DNA prime-VACV boost regimen elicits high levels of T-cell functional avidity, how VACV tunes the low avidity of CD8+ T cells primed by DNA into higher ones in vivo is less defined. Herein, we proved that the enhancement of CD8+ T cell avidity induced by VACV boost is mediated by the intrinsic MyD88 pathway but not MyD88-mediated inflammatory milieu, which might provide prompts in vaccine design.

  • Cycling memory CD4+ T cells in HIV disease have a diverse TCR repertoire and a phenotype consistent with bystander activation [PublishAheadOfPrint]

  • Background: The mechanisms of increased memory CD4+ T cell cycling in HIV disease are incompletely understood but have been linked to antigen stimulation, to homeostatic signals or exposure to microbial products and the inflammatory cytokines they induce.

    Methods: We examined phenotype and Vbbeta; family distribution in cycling memory CD4+ T cells among 52 healthy and 59 HIV+ donors.

    Results: Cycling memory CD4+ T cells were proportionally more frequent in HIV infection than in controls, more often expressed CD38 and PD-1, and less frequently expressed OX40 and intracellular CD40L. OX40 expression on memory CD4+ T cells was induced in vitro by CD3, IL-2, IL-7 or IL-15, but not by TLR ligands. In HIV+ donors, memory CD4+ T cell cycling was related directly to plasma LPS levels, to plasma HIV RNA levels, to memory CD8+ T cell cycling and inversely to peripheral blood CD4+ T cell counts, but not to levels of IL-2, IL-7 or IL-15 while in HIV- donors, memory CD4+ T cell cycling was related to IL-7 levels and negatively to plasma levels of LPS. In both controls and HIV+ donors, cycling of memory CD4+ T cells had broad distribution of Vbbeta; families comparable to that of non-cycling cells.

    Conclusions: Increased memory CD4+ T cell cycling in HIV disease is reflective of generalized immune activation and not driven primarily by cognate peptide stimulation or exposure to common gamma chain cytokines. This cycling may be a consequence of exposure to microbial products, to plasma viremia or otherwise through proinflammatory cytokines.

    Importance: This work provides evidence that the increased memory CD4+ T cell cycling in HIV infection is not a result of cognate peptide recognition but rather is more likely related to the inflammatory environment of HIV infection.

    Return To Top of the Page